ID: 900412685

View in Genome Browser
Species Human (GRCh38)
Location 1:2520065-2520087
Sequence CCCTCATCGCGTGGGACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 25}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900412671_900412685 21 Left 900412671 1:2520021-2520043 CCAAGCCCATGGCAGGAGGCACG 0: 1
1: 0
2: 3
3: 20
4: 239
Right 900412685 1:2520065-2520087 CCCTCATCGCGTGGGACCAAAGG 0: 1
1: 0
2: 1
3: 0
4: 25
900412666_900412685 30 Left 900412666 1:2520012-2520034 CCCCAGAAACCAAGCCCATGGCA 0: 1
1: 0
2: 2
3: 45
4: 509
Right 900412685 1:2520065-2520087 CCCTCATCGCGTGGGACCAAAGG 0: 1
1: 0
2: 1
3: 0
4: 25
900412674_900412685 15 Left 900412674 1:2520027-2520049 CCATGGCAGGAGGCACGCGCGGG 0: 1
1: 0
2: 1
3: 3
4: 131
Right 900412685 1:2520065-2520087 CCCTCATCGCGTGGGACCAAAGG 0: 1
1: 0
2: 1
3: 0
4: 25
900412668_900412685 28 Left 900412668 1:2520014-2520036 CCAGAAACCAAGCCCATGGCAGG 0: 1
1: 0
2: 3
3: 15
4: 245
Right 900412685 1:2520065-2520087 CCCTCATCGCGTGGGACCAAAGG 0: 1
1: 0
2: 1
3: 0
4: 25
900412667_900412685 29 Left 900412667 1:2520013-2520035 CCCAGAAACCAAGCCCATGGCAG 0: 1
1: 0
2: 3
3: 59
4: 542
Right 900412685 1:2520065-2520087 CCCTCATCGCGTGGGACCAAAGG 0: 1
1: 0
2: 1
3: 0
4: 25
900412672_900412685 16 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412685 1:2520065-2520087 CCCTCATCGCGTGGGACCAAAGG 0: 1
1: 0
2: 1
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900412685 Original CRISPR CCCTCATCGCGTGGGACCAA AGG Intronic
900412685 1:2520065-2520087 CCCTCATCGCGTGGGACCAAAGG + Intronic
913178655 1:116298236-116298258 CCCTCATTGCCTGGGGCCAGTGG + Intergenic
916743360 1:167665133-167665155 CACTGATTGCGTGGGACCAGTGG - Intronic
1067296795 10:44979254-44979276 CCCTGCTCGCAAGGGACCAAGGG + Intronic
1073563260 10:104514993-104515015 CCTTCAATGCGTGTGACCAAAGG - Intergenic
1092265460 12:6977373-6977395 GCCTCTTCACGTGGGACAAATGG - Exonic
1094422118 12:30281338-30281360 CCCACAACACGTGGGACCCAGGG + Intergenic
1098953198 12:76662970-76662992 CCCTCTTGGAGTTGGACCAATGG + Intergenic
1103288404 12:119823103-119823125 CCCTCTTCCCTTTGGACCAAAGG + Intronic
1108458919 13:50645491-50645513 CCCTCATTGAGAGAGACCAATGG - Intronic
1112616902 13:101015597-101015619 CCTTCATCCCTTGGGACCAGGGG - Intergenic
1122928547 14:104922745-104922767 CCCACACCCCATGGGACCAAAGG + Intergenic
1133203844 16:4221020-4221042 CCCTCATCGCCTGGGACCATGGG + Intronic
1136356636 16:29748465-29748487 CCCTCACTGCCTGGGGCCAATGG - Intergenic
1148858562 17:50592270-50592292 CCCTCATCACATGGGACACAGGG + Intronic
1152360760 17:79832142-79832164 CCCTGCCCGCCTGGGACCAAGGG - Intergenic
1154148264 18:11884749-11884771 CCCTCCTCACCTGAGACCAAGGG + Exonic
927990433 2:27443215-27443237 CCCTCATCCAGTGGTACCAGAGG - Exonic
938139277 2:128783065-128783087 CCCTCATTTCGTGTGGCCAAAGG + Intergenic
942358977 2:175151776-175151798 CCATGATCGCCTGGAACCAAGGG + Intronic
968623216 4:1613897-1613919 CCCTCTTTGCGTGGGACCTGAGG - Intergenic
984069283 4:175092220-175092242 CCCTCACTGCCTGGGACCACTGG - Intergenic
1000419427 5:161021415-161021437 CCCTCATAGCTTTGGCCCAAAGG - Intergenic
1018411296 6:163551318-163551340 CCCTCAACCTGTGGGACCTAAGG - Intronic
1025559802 7:62357402-62357424 CCCTCATCGAATGGAATCAAAGG + Intergenic
1036645685 8:10610527-10610549 CCGTCATGGCATGGGACCCAAGG + Exonic
1053181974 9:35980403-35980425 CCCTCATCTCCTGGAACCACAGG + Intergenic