ID: 900412687

View in Genome Browser
Species Human (GRCh38)
Location 1:2520069-2520091
Sequence CATCGCGTGGGACCAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 37}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900412672_900412687 20 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412687 1:2520069-2520091 CATCGCGTGGGACCAAAGGCAGG 0: 1
1: 0
2: 1
3: 2
4: 37
900412674_900412687 19 Left 900412674 1:2520027-2520049 CCATGGCAGGAGGCACGCGCGGG 0: 1
1: 0
2: 1
3: 3
4: 131
Right 900412687 1:2520069-2520091 CATCGCGTGGGACCAAAGGCAGG 0: 1
1: 0
2: 1
3: 2
4: 37
900412671_900412687 25 Left 900412671 1:2520021-2520043 CCAAGCCCATGGCAGGAGGCACG 0: 1
1: 0
2: 3
3: 20
4: 239
Right 900412687 1:2520069-2520091 CATCGCGTGGGACCAAAGGCAGG 0: 1
1: 0
2: 1
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900412687 Original CRISPR CATCGCGTGGGACCAAAGGC AGG Intronic
900412687 1:2520069-2520091 CATCGCGTGGGACCAAAGGCAGG + Intronic
903754180 1:25649392-25649414 CACAGTGTGGGACCTAAGGCTGG + Intronic
904671789 1:32171541-32171563 CATTGCCTGGGACTAGAGGCTGG + Exonic
907354323 1:53859779-53859801 CCTCTACTGGGACCAAAGGCAGG + Intronic
908932541 1:69334378-69334400 CATTTCCTGGGACCAAAGGCTGG - Intergenic
1063365487 10:5487822-5487844 CATCTCCTGGGCCCAGAGGCCGG + Intergenic
1067112104 10:43408318-43408340 CACCGCGTGGGACCACTGTCTGG + Intronic
1070643143 10:78183206-78183228 CACTGCCTGGGACAAAAGGCAGG - Intergenic
1075122044 10:119671479-119671501 CATCCCGTGTGGCCCAAGGCAGG - Intronic
1076055471 10:127368669-127368691 CATCTCCTGTGACCAAGGGCAGG - Intronic
1078474602 11:11620448-11620470 CAGCGCGGGGGTCCAAAGGGAGG - Intronic
1083987819 11:66228231-66228253 CATCCCGTGGGACCAGAGGCAGG + Intronic
1091651228 12:2311597-2311619 CATCACGGGGAACCAAGGGCAGG + Intronic
1109087571 13:57995620-57995642 CATCTCGTCGCACCAAAGGATGG - Intergenic
1129377498 15:75143326-75143348 CATCGCATGGGACCAGAAGGAGG - Intergenic
1149320857 17:55479232-55479254 CATTGCTTAGGACCACAGGCAGG + Intergenic
1152756296 17:82088462-82088484 CATCAAGTGGGACCACAGCCTGG - Exonic
1154502814 18:15005016-15005038 CCACGCCTGGGACCAAATGCAGG + Intergenic
1161617971 19:5282821-5282843 CACGCCGTGTGACCAAAGGCAGG - Intronic
1164784490 19:30919313-30919335 CATCCCATGGGACAAAGGGCTGG - Intergenic
1167012931 19:46820905-46820927 CATCCCGGGGGAGGAAAGGCCGG + Intergenic
938501983 2:131835184-131835206 CCACGCCTGGGACCAAATGCAGG + Intergenic
1172298070 20:33827810-33827832 CATCCTGTGGCCCCAAAGGCGGG - Intronic
1179912184 21:44456190-44456212 CACCGCTGGGGACCAAAGGCCGG - Intronic
1184467524 22:44677542-44677564 CATGGGGTGGGACGAAGGGCAGG + Intronic
1184861219 22:47174256-47174278 GAGGCCGTGGGACCAAAGGCTGG + Exonic
949537170 3:5005020-5005042 CTTCCCGTGGCCCCAAAGGCTGG + Intergenic
952255106 3:31688209-31688231 CATCGTGTGAGACCAGAGGGAGG - Intronic
952976095 3:38697831-38697853 TATCTCCAGGGACCAAAGGCAGG + Exonic
977969641 4:103198479-103198501 CAGCGCGGGGGACGCAAGGCGGG + Intergenic
998282116 5:140821913-140821935 CATCGCGCAGGACCTAGGGCTGG + Exonic
999197870 5:149794960-149794982 CATGGCCTTGGACCCAAGGCAGG - Intronic
1006824344 6:36923396-36923418 CATCGCAGATGACCAAAGGCTGG - Exonic
1011706430 6:90005617-90005639 CAGCACGTGGGTCCACAGGCAGG + Intronic
1022649025 7:32258106-32258128 CTGCGCTTGGGGCCAAAGGCAGG + Intronic
1032229689 7:130063851-130063873 CAGCGTCTGGGACCACAGGCGGG + Intergenic
1037202555 8:16275865-16275887 CATCCCCTGGCACCAAATGCGGG - Intronic
1038674025 8:29607148-29607170 CATGGCATGGAGCCAAAGGCAGG - Intergenic
1047255408 8:123209976-123209998 CATCGCTTAGGACCCCAGGCTGG - Intronic
1049597640 8:143492125-143492147 CGTTGCATGGGACCAAAGGGTGG + Intronic
1049813239 8:144585677-144585699 CAGCGCGTGGCACCATGGGCGGG - Intronic