ID: 900412689

View in Genome Browser
Species Human (GRCh38)
Location 1:2520075-2520097
Sequence GTGGGACCAAAGGCAGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 449}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900412672_900412689 26 Left 900412672 1:2520026-2520048 CCCATGGCAGGAGGCACGCGCGG 0: 1
1: 0
2: 1
3: 1
4: 64
Right 900412689 1:2520075-2520097 GTGGGACCAAAGGCAGGAGGCGG 0: 1
1: 0
2: 3
3: 57
4: 449
900412674_900412689 25 Left 900412674 1:2520027-2520049 CCATGGCAGGAGGCACGCGCGGG 0: 1
1: 0
2: 1
3: 3
4: 131
Right 900412689 1:2520075-2520097 GTGGGACCAAAGGCAGGAGGCGG 0: 1
1: 0
2: 3
3: 57
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900412689 Original CRISPR GTGGGACCAAAGGCAGGAGG CGG Intronic
900412689 1:2520075-2520097 GTGGGACCAAAGGCAGGAGGCGG + Intronic
900636683 1:3669456-3669478 GTGGGTCCAAGGGGTGGAGGTGG - Intronic
900753747 1:4418637-4418659 GTGGGAGGGAAGGAAGGAGGAGG - Intergenic
900925925 1:5705919-5705941 GTGGGACTAAAGACAGCAGAAGG + Intergenic
901023017 1:6264570-6264592 GAGGCACCAGTGGCAGGAGGAGG + Exonic
901049692 1:6420002-6420024 GCAGGAACAAAGGCAGGAGGTGG - Intronic
901052753 1:6433697-6433719 ATGGGACCACAGCCCGGAGGAGG - Intronic
901058851 1:6462363-6462385 GGGGGACAAGAGGAAGGAGGCGG - Intronic
901747478 1:11383921-11383943 GAGGGGCCCAAGGCAGGAGAGGG + Intergenic
902553890 1:17235450-17235472 GTAGGACCTCAGGCAGGAGGGGG + Intronic
902635135 1:17729941-17729963 GTGGAACCCAAGGCAGCATGGGG - Intergenic
903065622 1:20697734-20697756 ATGGAGCCAAAGGCAGGAGTGGG + Intronic
903226684 1:21897738-21897760 TTGGGACCAAGGGCAGGCTGGGG + Intronic
903779963 1:25814820-25814842 GTGGGACCCAGGGCTGTAGGAGG + Intronic
904275783 1:29383352-29383374 CTGTGAGCAGAGGCAGGAGGTGG + Intergenic
904407390 1:30301365-30301387 GTGGGAAGAAAGGCAGGGGAGGG + Intergenic
904407805 1:30304793-30304815 GATGGACCTGAGGCAGGAGGTGG + Intergenic
904459780 1:30669402-30669424 GTTTGACCAAAGGCTGGAAGTGG - Intergenic
905345539 1:37308790-37308812 TTGGGTCTGAAGGCAGGAGGTGG + Intergenic
905504369 1:38465499-38465521 GCTGGGCCAGAGGCAGGAGGAGG - Intergenic
905773345 1:40652543-40652565 GTGGCTCTAAAGGAAGGAGGCGG + Intronic
905948366 1:41923466-41923488 GTGGTACCAGAGGCTGGAGGAGG + Intronic
905986752 1:42291992-42292014 GTGGGAGGAAAGGCAGGAGTGGG + Intronic
906287942 1:44600154-44600176 CTGAAACCAAAAGCAGGAGGAGG + Intronic
906337475 1:44946258-44946280 CTGGGAACAGAGGCAGGAGAGGG - Intronic
907391394 1:54160652-54160674 GTGGGAAGAAAGTAAGGAGGGGG + Intronic
907445027 1:54501970-54501992 GAGGGACCAAAGGCTGGTGAGGG - Intergenic
908261734 1:62344345-62344367 GTGAGACCCCAGGCCGGAGGAGG + Intergenic
910236096 1:85037981-85038003 GTGGCACCAAAAGCAAGAGGTGG + Intronic
911107162 1:94142784-94142806 GTGGGACAAGAGGAGGGAGGCGG - Intergenic
911556160 1:99347338-99347360 GTTCCACCAAAGGCAGGGGGTGG - Intergenic
912755888 1:112324714-112324736 GTGGGCCCAAGTGCAGGTGGTGG - Intergenic
915147207 1:153802265-153802287 GTGGTACCAGGGGCAGGAGAAGG + Intergenic
915368131 1:155326722-155326744 GTGGGCCCAGGGGCAGGTGGTGG - Exonic
916507234 1:165439291-165439313 GTGGGAGCGAGGGGAGGAGGGGG + Intronic
918221677 1:182441232-182441254 GTGGGAGGAGAGGCAAGAGGGGG + Intergenic
918815108 1:189171509-189171531 GGGGGAGAAAAGGCAGGAGTGGG - Intergenic
920173374 1:204085066-204085088 GTGGGATTTAGGGCAGGAGGTGG + Intronic
922415533 1:225419086-225419108 GTGGGTGCAAAGGCTTGAGGTGG - Intronic
922930570 1:229386008-229386030 GTGGGTCAGGAGGCAGGAGGAGG + Intergenic
923169013 1:231395961-231395983 GTGGGAGCAAAGTCAGAAAGCGG - Intronic
923372777 1:233328838-233328860 GTGGGGCCAGAGGGAGGTGGGGG + Intronic
923482380 1:234397320-234397342 GTGGGAGGAGAGGGAGGAGGGGG + Intronic
1062805060 10:413075-413097 TTGGGAGCTGAGGCAGGAGGAGG - Intronic
1063368638 10:5507136-5507158 GTCGGGCCAGAGGGAGGAGGCGG - Intergenic
1064175635 10:13072560-13072582 GTGGAGCCACAGGCAGGGGGAGG + Intronic
1064409503 10:15092837-15092859 GGGGGAAGAAAGGGAGGAGGGGG + Intergenic
1067060636 10:43076491-43076513 CTGGGGCCGGAGGCAGGAGGCGG - Intergenic
1067656579 10:48196655-48196677 GTGGGACCATCAGCTGGAGGCGG + Intronic
1070573071 10:77656198-77656220 ATGGGAACACTGGCAGGAGGTGG + Intergenic
1070807960 10:79281723-79281745 GTGGGAGCACAGGGAGGTGGAGG + Intronic
1071545632 10:86526815-86526837 GAGGGCCCACAGGCAGGAGCTGG - Intergenic
1072447117 10:95508896-95508918 GAGAGACAAAGGGCAGGAGGTGG + Intronic
1073055736 10:100699969-100699991 GTGAGACCAAAGGAATGGGGAGG - Intergenic
1073137477 10:101227962-101227984 GGGAGACCAAAGACAGGAGATGG - Intronic
1073998277 10:109340988-109341010 GTGGGAACGTAGGCAGTAGGTGG + Intergenic
1075424618 10:122332026-122332048 GGGGGACAAAAGGAAGGAGGTGG - Intronic
1075702269 10:124477415-124477437 GTGGCCCCAGAGGCAGGAGCAGG + Intronic
1075710935 10:124530204-124530226 GTGGGGCGGGAGGCAGGAGGCGG - Intronic
1075936697 10:126348496-126348518 GTGGGAACAAATGCAAGAGGGGG + Intronic
1076358442 10:129869406-129869428 GGGGGAGCAAAGCCAGGAGCTGG - Intronic
1076668562 10:132106459-132106481 GAGGGACTCATGGCAGGAGGGGG - Intronic
1076813121 10:132899341-132899363 GTGGGTACAAGGGCAAGAGGGGG + Intronic
1076904260 10:133354497-133354519 GAGGGACCAAGGGCAGGAGTGGG - Intergenic
1077890833 11:6417108-6417130 GTGTGACCAAAGCCAGGGGCAGG - Intronic
1079459984 11:20670350-20670372 TTGGGAGCAAAGACAGGCGGAGG - Intronic
1079989267 11:27229996-27230018 GTGGAAAGAAAGGCAGGGGGTGG + Intergenic
1080419165 11:32094805-32094827 TGGGGACCAGAGGCAGGACGGGG + Intronic
1080882199 11:36332752-36332774 GAGGGAGCAACAGCAGGAGGAGG - Intronic
1081526347 11:43930280-43930302 CTGAGACCAAGGGCAGGAAGAGG - Intronic
1081612978 11:44574287-44574309 GTGCGAGCAAAGGCTGGATGTGG - Intronic
1081776185 11:45677483-45677505 GTGGGAACATGGGCAGGAGCTGG - Intergenic
1083303050 11:61748734-61748756 GTGGGAGCAGGGCCAGGAGGAGG - Intergenic
1083331148 11:61898979-61899001 GTGGGAGCAAAGGCTGGAGGTGG + Intronic
1083396394 11:62395569-62395591 CTGAGACCAAAGGAAGGAGTGGG + Intergenic
1083429963 11:62609162-62609184 GTTAGATCAAGGGCAGGAGGAGG + Intronic
1084088051 11:66863737-66863759 CCGGGAGCAAAGGCAGGCGGGGG + Intronic
1084169763 11:67395482-67395504 GAGGGCCCAGAGGCAGGACGTGG - Intronic
1084320899 11:68372889-68372911 GTGGGGCGAAGGTCAGGAGGGGG + Intronic
1084334276 11:68447600-68447622 GCATGAGCAAAGGCAGGAGGTGG - Intronic
1084760212 11:71266119-71266141 GCGGGACCCAAGGCAGGTGGAGG - Intergenic
1085023848 11:73225257-73225279 GTGAGGCCAAAGTCAGGAGGAGG - Intronic
1085202062 11:74707807-74707829 CTGGGAGCAGAGGCAGGAGTGGG - Intronic
1086168588 11:83808981-83809003 GTGAGACCAGCTGCAGGAGGAGG - Intronic
1086445382 11:86865680-86865702 GTGGGACCAAAGCCAGGAATTGG - Intronic
1087119228 11:94555519-94555541 GTGGGAAGAGAGGGAGGAGGAGG - Intronic
1088651066 11:111958504-111958526 GAGGGAGCTAAGGCAGCAGGGGG - Intronic
1089278459 11:117355674-117355696 GTGGGAGCATAGGCAGCGGGAGG + Intronic
1089599561 11:119605067-119605089 GTGGGAGCAGAGGCTGGAGGTGG + Intergenic
1089665205 11:120013826-120013848 GTAGGAGTAAAGGCAGGAGCCGG - Intergenic
1089681333 11:120120562-120120584 ATGGCACCAAAGGTAGGTGGTGG - Exonic
1089810119 11:121124872-121124894 GGAGGACTAAAGGCAGGAAGGGG + Intronic
1089857553 11:121559896-121559918 CAGGGGCCAAGGGCAGGAGGAGG - Intronic
1090178966 11:124676738-124676760 GTGAGAGCAGAGGTAGGAGGAGG + Intronic
1090350476 11:126104733-126104755 GAGGGACCAGAGGCAGTGGGAGG - Intergenic
1090557265 11:127889936-127889958 CAGGGACCAAAGGCAGGTGCTGG - Intergenic
1091121853 11:133064108-133064130 GGCTGACCAAAGGAAGGAGGTGG + Intronic
1091191160 11:133696335-133696357 ATGGGAGCAAAGGCAGGGGTCGG + Intergenic
1091287715 11:134417343-134417365 ATGGGACCATAAGCAGGAGCTGG - Intergenic
1091300063 11:134502029-134502051 GTGGGGCCAGAGGCAGGAGGTGG + Intergenic
1091312658 11:134585723-134585745 TTGGGACCCAAGGCAGGTAGGGG + Intergenic
1091817135 12:3447041-3447063 CTGGGAGCTAAGGGAGGAGGAGG - Intronic
1091874609 12:3923744-3923766 GTTGGACAAAGGGAAGGAGGAGG - Intergenic
1092477862 12:8834457-8834479 GAGGGAAACAAGGCAGGAGGAGG - Intronic
1096217911 12:49808713-49808735 GTGGGTCCTGAGGGAGGAGGCGG - Intronic
1096232185 12:49902842-49902864 GTGTGACCAATGGCGGGAGGTGG + Intronic
1096677352 12:53232760-53232782 CTGGGACCAAAGGACTGAGGTGG - Intronic
1098024133 12:66184974-66184996 TTGGGGCCAAAGACAGAAGGGGG + Intergenic
1098523729 12:71462506-71462528 GTGAGAGCAAAGACAGGGGGAGG - Intronic
1098669251 12:73204356-73204378 GTGGAACAAGAGGAAGGAGGAGG + Intergenic
1098689623 12:73470680-73470702 TTGGGAGAAAGGGCAGGAGGGGG + Intergenic
1100093735 12:91005987-91006009 ATGGGAGCAGAGGCAGGAAGGGG - Intergenic
1101299100 12:103459459-103459481 GTGGGAGCAAGAGCAGGGGGAGG - Intronic
1101335702 12:103794749-103794771 GTGGTACCAAAGAGAGAAGGAGG - Intronic
1101406344 12:104432521-104432543 GCAGGAGAAAAGGCAGGAGGGGG - Intergenic
1101415769 12:104506952-104506974 GTGGGAGCAGAGGCAGGTGCTGG + Intronic
1101935455 12:109052993-109053015 CTGGGAACAATGACAGGAGGGGG - Intronic
1102245558 12:111353608-111353630 AAGGAACCATAGGCAGGAGGTGG + Intergenic
1102298872 12:111757164-111757186 GAGGAAACACAGGCAGGAGGAGG - Intronic
1102520237 12:113473096-113473118 CTGGGACCAAGGGCTGGAGCTGG + Intergenic
1102544167 12:113642677-113642699 GAGGGAGCAAAGGAAGGAAGAGG - Intergenic
1102588515 12:113940184-113940206 ATGGGACCACAGGAGGGAGGAGG + Intronic
1103367013 12:120390765-120390787 GAGGGAAGAAAGGAAGGAGGAGG + Intergenic
1104279128 12:127357775-127357797 GTGAGACCAAGGGGAGAAGGAGG - Intergenic
1104372158 12:128232930-128232952 GTGGGGCCTAAGGTGGGAGGAGG + Intergenic
1104664006 12:130634525-130634547 GCTGGACCAAAGGCAGCATGTGG - Intronic
1104672460 12:130690118-130690140 GAGGGAGCAGAGGCAGGAGGAGG - Intronic
1104928817 12:132327881-132327903 GTGGGGGCAAAGGCGGGGGGTGG - Intronic
1104992162 12:132631842-132631864 CTGGGACCAGGTGCAGGAGGAGG - Intronic
1105068581 12:133220093-133220115 GAGAGGCGAAAGGCAGGAGGAGG + Intronic
1105712759 13:23028938-23028960 GTGGGACCTAATGCAGGGGGTGG + Intergenic
1105812711 13:24008918-24008940 CTGGGACCAAGTGCGGGAGGTGG + Intronic
1107624927 13:42272334-42272356 GGGGGACCAGCGGCAGGCGGAGG - Intronic
1107699293 13:43032018-43032040 GTAGGGCCAAAGGGAGGAGTTGG + Intronic
1107733402 13:43370909-43370931 GAGGGAGGAAGGGCAGGAGGGGG - Intronic
1107837453 13:44423265-44423287 GAGGGAGTAAAGGGAGGAGGTGG + Intergenic
1108002091 13:45913181-45913203 GTGGGACCAGAGGCAGGGAAGGG + Intergenic
1108729769 13:53222734-53222756 TTGGGACCAGTAGCAGGAGGAGG + Intergenic
1112452712 13:99526555-99526577 GTTGGAACAACGGGAGGAGGTGG + Intronic
1112475790 13:99730008-99730030 GTGGGACCAACGGTGGTAGGGGG - Intronic
1113129823 13:107023491-107023513 GTGGGGGCAAGGGCAAGAGGAGG - Intergenic
1113420280 13:110165612-110165634 GTGGAACCCAAGGAAGGAGAGGG - Intronic
1113552508 13:111204161-111204183 AAGGGACCGAAGGCAGGAAGAGG + Intronic
1113803808 13:113101803-113101825 CGGGGAGCAGAGGCAGGAGGAGG + Intergenic
1114457464 14:22865498-22865520 GGAGGAACAAAGGGAGGAGGTGG + Intergenic
1114671703 14:24415136-24415158 GTGGGACCAGGAGCATGAGGAGG + Exonic
1114679882 14:24475420-24475442 GTGGAAGCACTGGCAGGAGGTGG + Intergenic
1115023146 14:28707573-28707595 GTGGGACCAAAAGCAAGAAGGGG + Intergenic
1115643051 14:35347570-35347592 GGGAGATCAAAGGGAGGAGGGGG + Intergenic
1116328025 14:43558877-43558899 GTGGGAGGGAAGGGAGGAGGTGG - Intergenic
1117937260 14:60920115-60920137 GTGGGGCCAGAGGCTGGGGGCGG + Intronic
1119758831 14:77137503-77137525 GTGTGAGCACAGGCAGGTGGAGG - Intronic
1120825231 14:88948926-88948948 TAGGAACCAAAGCCAGGAGGAGG + Intergenic
1121098360 14:91233484-91233506 GGGGGAAGGAAGGCAGGAGGGGG - Exonic
1121690678 14:95875850-95875872 GAGAGACCAGAGGAAGGAGGAGG + Intergenic
1122075443 14:99232042-99232064 GGCGGACCCAAGGCTGGAGGCGG - Intronic
1122688127 14:103519537-103519559 ATGGGACAAGAGCCAGGAGGTGG - Intergenic
1122893356 14:104743107-104743129 GAGTGACCACAGGCAGGAAGAGG + Exonic
1123450620 15:20357278-20357300 GTGGGACCAGAGAGAGGGGGTGG + Intergenic
1123699510 15:22903908-22903930 GTGGCACCAAAGACAGGGGTGGG + Intronic
1125142537 15:36425866-36425888 TGGGGAACAAAGGCAGGAAGAGG - Intergenic
1125862013 15:43008423-43008445 GAGGGGTCCAAGGCAGGAGGGGG - Intronic
1126675237 15:51155158-51155180 GTGGGACCGCAGGAATGAGGAGG - Intergenic
1127849526 15:62900952-62900974 GTGGTAACAAAGGCAGCAGGAGG + Intergenic
1128525105 15:68407096-68407118 ATGGGACCTAGGGCAGGAAGCGG - Intronic
1129577340 15:76764369-76764391 GTGGGAGCCAAGGCAGGTCGTGG + Intronic
1131266423 15:90918145-90918167 GAGGGACCAAAGCCAGGCTGAGG - Intronic
1131838791 15:96415527-96415549 CTGGGGCCCAAGGCTGGAGGTGG + Intergenic
1131851237 15:96545643-96545665 GTGGCACCAGAGGCAGGAAAAGG - Intergenic
1132155419 15:99492496-99492518 GTGAAGCCAAAGTCAGGAGGGGG - Intergenic
1132461951 16:59860-59882 GTGGGGCCAAAGGTTGGGGGAGG - Intronic
1132553837 16:564245-564267 CAGGGACCCAGGGCAGGAGGGGG + Exonic
1132745503 16:1434588-1434610 GGGGGCCCACAGGCAGCAGGTGG - Intronic
1133288133 16:4700568-4700590 GAGGGACCACAGAAAGGAGGAGG + Intronic
1133634945 16:7656417-7656439 GTGGGACCCAGGGCAGGAGCTGG + Intronic
1133773836 16:8883227-8883249 GGAGGACCATAGGGAGGAGGGGG - Intergenic
1134219601 16:12343550-12343572 CTGAGGCCAAAGGCAGGAAGAGG - Intronic
1135053378 16:19210767-19210789 GTGAGAGCAAAGGCATAAGGGGG + Intronic
1137283341 16:46996466-46996488 GAGAGATCAGAGGCAGGAGGCGG + Intergenic
1138428151 16:56950303-56950325 CTGAGAGCAAAGGCAGGTGGGGG + Intergenic
1138491099 16:57377188-57377210 GAGTGACCAGAGACAGGAGGAGG - Intronic
1138530492 16:57631805-57631827 GGGGCACCAGAGACAGGAGGAGG - Intronic
1139332656 16:66205541-66205563 GGGGGAAGACAGGCAGGAGGGGG + Intergenic
1139637734 16:68268367-68268389 CTGTGACCAAATGCCGGAGGGGG - Intronic
1139640831 16:68290371-68290393 GTGGGGGCAAAGGCAGGTGAGGG - Intronic
1141553046 16:84819051-84819073 TGGGGCCCAAGGGCAGGAGGGGG - Intergenic
1142136088 16:88452717-88452739 GAGGGACCAAGGGCTGGGGGCGG + Intergenic
1142200344 16:88758102-88758124 GTGGGACCACAGGGCTGAGGAGG - Intronic
1142468007 17:147059-147081 GTGGGAACAGAGGAGGGAGGTGG - Exonic
1142719442 17:1766670-1766692 GTGGGCCCTGAGGCAGGGGGAGG + Intronic
1142928290 17:3260079-3260101 GTGGGACTCAAGGCTGGAGCAGG - Intergenic
1143542412 17:7577488-7577510 GTGGGGCCCAGTGCAGGAGGCGG + Intronic
1143788149 17:9272149-9272171 GTGGGACCAACAGCAGCAGCTGG + Intronic
1144125237 17:12196962-12196984 GTGGGACTCAACTCAGGAGGTGG + Intergenic
1144125241 17:12196981-12197003 GTGGGACCTGACGCCGGAGGTGG + Intergenic
1144579614 17:16450947-16450969 GTGGGTGAGAAGGCAGGAGGGGG + Intronic
1145248530 17:21285032-21285054 GTGGGACCAAAGAAAGGTCGGGG - Intronic
1145275293 17:21425522-21425544 GTGGGACCCACAGCAGGAAGTGG - Intergenic
1145313147 17:21711416-21711438 GTGGGACCCACAGCAGGAAGTGG - Intergenic
1145711599 17:26983372-26983394 GTGGGACCCACAGCAGGAAGTGG - Intergenic
1145863452 17:28226150-28226172 TTGGGAAAAGAGGCAGGAGGAGG - Intergenic
1145941679 17:28746066-28746088 GTGGGATCAAGGGGAGGAGGTGG + Intronic
1146013543 17:29214674-29214696 GAGGGAAGACAGGCAGGAGGTGG - Intergenic
1146783906 17:35701859-35701881 GGGAGACCAAAGGCGGAAGGAGG - Intronic
1146809410 17:35891265-35891287 GTGGGGCCAAGGGCAGGGGTGGG - Intergenic
1147158472 17:38557458-38557480 GAGGGCCCAAAGGAAGGAGCAGG + Intronic
1147469631 17:40647644-40647666 GTGGGGCCAGAGCCAGGAGCCGG - Intronic
1147927500 17:43954560-43954582 GTTGGAAAAGAGGCAGGAGGAGG + Intronic
1147976298 17:44250116-44250138 GTAGAAGCAAAGGCAGGAGGTGG - Exonic
1149161886 17:53703810-53703832 TTGGGGCCAGAGGCTGGAGGTGG + Intergenic
1150143636 17:62750414-62750436 GTGGCACTAGTGGCAGGAGGAGG + Intronic
1151536580 17:74742296-74742318 GTGAGACCAGAGGCTGGAGTTGG + Intronic
1151955296 17:77377067-77377089 GGGGGAGCAAAGGCGGGATGCGG - Intronic
1152337818 17:79708057-79708079 GTGGGACCAGAGACAGGGGGTGG - Intergenic
1152926853 17:83091291-83091313 ATGGAAGCAAATGCAGGAGGAGG + Intronic
1153191530 18:2545990-2546012 CTGGGACCAAAGTCAGGAGGAGG - Intronic
1153693490 18:7616769-7616791 GTGGGAAGACAGGCAGGATGGGG - Intronic
1154009905 18:10565531-10565553 GTGGGGCCAAAGGCAGGGAGTGG - Intergenic
1154473119 18:14723978-14724000 CTGGGGGCAAAGGCAGGTGGGGG - Intergenic
1157002929 18:43549113-43549135 GTGGGAGAGAAGGGAGGAGGAGG + Intergenic
1158602191 18:58864300-58864322 GAGGGACGGAAGGGAGGAGGGGG + Intronic
1159700138 18:71616425-71616447 TTTGGAACAAAGGCAGTAGGTGG + Intergenic
1159877368 18:73827545-73827567 GTGGGAGCAAGAGGAGGAGGGGG + Intergenic
1161272400 19:3397354-3397376 GTAGGCCCAAAGGCAGGATCCGG - Intronic
1161571180 19:5031643-5031665 GGTGGACCCAAGGCAGTAGGTGG + Intronic
1162174929 19:8823542-8823564 GGGTGACCAAGGGCAGGAGTTGG - Intronic
1162905105 19:13818479-13818501 GTGGGGCCAGAGGGTGGAGGTGG - Intronic
1163514762 19:17756131-17756153 GAGGGAGCAAGGGCAGGAGTGGG - Intronic
1163709915 19:18840340-18840362 ATGAGACCACAGGCAGGAGCTGG - Intronic
1164828301 19:31300610-31300632 GTGGGACCTGGAGCAGGAGGTGG - Intronic
1165326199 19:35115808-35115830 GCGTGACCAAAGTCAGGAGATGG - Intergenic
1165385132 19:35505874-35505896 GTGGGGCCAAGGGCAGGGGTTGG + Intronic
1165454446 19:35902614-35902636 CTGGGAGCAAAAGCAGGAAGAGG - Exonic
1165458037 19:35926216-35926238 GGAGGAACAAAGGGAGGAGGTGG - Intergenic
1166053542 19:40275174-40275196 TTGGGAGCAAAGGCAGAAGGAGG - Intronic
1166326496 19:42054112-42054134 ATGGGACAAAAGGCATGAAGAGG + Intronic
1166496671 19:43307881-43307903 GTGGGGCCACAGGGAGAAGGTGG - Intergenic
1166984936 19:46654120-46654142 AGTGGACCAAAGGCAGAAGGAGG - Intronic
1167013600 19:46825070-46825092 GTGGGCGCCAAGGCAGGTGGTGG - Intergenic
1167249160 19:48391507-48391529 GGGGGAGCAAAGGCTGGAGCTGG + Exonic
1167253612 19:48414658-48414680 CTGGGTCCCAAGGGAGGAGGGGG - Intronic
1167504440 19:49863688-49863710 GTGGGACCATCTGCAGGAGCAGG - Exonic
1167539650 19:50077207-50077229 GAGTCAGCAAAGGCAGGAGGCGG - Intergenic
1167591273 19:50405830-50405852 GTGGGGGCAGAGGCAGGAGGCGG - Intronic
1167630059 19:50620663-50620685 GAGTCAGCAAAGGCAGGAGGCGG + Intergenic
1168567627 19:57438340-57438362 GTAGGATGAAAGGGAGGAGGAGG - Exonic
925865447 2:8222610-8222632 GTGGGGCCACAGGGAGAAGGTGG - Intergenic
925948903 2:8893044-8893066 GGGGCACCAGAGGCAGGGGGAGG + Intronic
926054662 2:9767552-9767574 GAGGGAACTCAGGCAGGAGGAGG + Intergenic
927433616 2:23047974-23047996 GTGGGATGGAAGGCTGGAGGTGG + Intergenic
927482708 2:23467089-23467111 GGGTCACCAAAGGCAGGAGAAGG - Intronic
927553366 2:24017126-24017148 AGGGTCCCAAAGGCAGGAGGGGG - Intronic
928145356 2:28769721-28769743 GTAGAACAAAAGGCTGGAGGCGG + Intronic
928205810 2:29282593-29282615 GGGGAAACCAAGGCAGGAGGTGG - Intronic
929655732 2:43729954-43729976 GTGGAAGCAAAGGCAGAGGGAGG - Intronic
931180168 2:59891599-59891621 GTGCTGCCAAAGGAAGGAGGTGG + Intergenic
931749262 2:65316606-65316628 GTGGGGGTAAAGGCAGGAGCAGG + Intronic
931757694 2:65388658-65388680 AAAGGACCAAAAGCAGGAGGGGG + Intronic
932451485 2:71813425-71813447 GTGGGACCCAAAGCAGGGGCTGG + Intergenic
932471725 2:71963533-71963555 GAGGGAGCTAAGGCAGGAGCTGG - Intergenic
932882887 2:75520193-75520215 GTGTGACCAAAAGCATGAAGAGG - Intronic
933731032 2:85456420-85456442 GTGAGAGAGAAGGCAGGAGGAGG - Intergenic
933737373 2:85505911-85505933 GTGGGACCATAGACAGGAAGAGG - Intergenic
933813338 2:86047110-86047132 GTGTCAGCAAAGGCAGGTGGGGG - Intronic
933978894 2:87534558-87534580 GGGGGAAAAAAGGAAGGAGGTGG - Intergenic
934551967 2:95268237-95268259 GTGGTCCCGATGGCAGGAGGAGG - Intergenic
935981632 2:108634052-108634074 GTGGCTCCAAAGGAAAGAGGAGG + Intronic
936108510 2:109646076-109646098 GAAGGACCAAATGCCGGAGGAGG - Intergenic
937078641 2:119125040-119125062 GTGTGAGCAGAGGCAGGAGCTGG + Intergenic
937263179 2:120599277-120599299 GTGGGCGTGAAGGCAGGAGGGGG + Intergenic
937278151 2:120699492-120699514 GTGTGACAAAAGCCAGGAGGTGG + Intergenic
937904977 2:127048726-127048748 GAGGCACCAACAGCAGGAGGAGG - Intronic
938235237 2:129700440-129700462 GTGAGGCCAGAGTCAGGAGGAGG - Intergenic
938991739 2:136636611-136636633 GTGGGACATGAGGTAGGAGGAGG - Intergenic
939065876 2:137482836-137482858 GTGAGAGGAAAGGCAGGAAGTGG + Intronic
941997104 2:171611243-171611265 GAGGGAGCAAGGGAAGGAGGGGG - Intergenic
942044835 2:172094483-172094505 ATGGGGCCGAAGGAAGGAGGAGG - Intergenic
942970371 2:181950972-181950994 GAGGGACCAGAGGAAGGAGCTGG - Intergenic
944316555 2:198291309-198291331 GTGGACCCAGAGGCTGGAGGTGG - Intronic
946148406 2:217748059-217748081 GATGGGCCCAAGGCAGGAGGAGG - Intronic
946281382 2:218668200-218668222 GTGGCAGCAAAGGGAGGAAGGGG - Intronic
946309140 2:218873103-218873125 CAGGGTCCAAAGGCAGGGGGTGG - Intronic
946863981 2:224026163-224026185 GTGGAACCACAGACAGGAAGAGG + Intronic
947573994 2:231258095-231258117 ATGGGAACATAGGCAGGAGATGG - Intronic
948670325 2:239564367-239564389 GAGGGAACAAAGCCAGGAGGTGG + Intergenic
948895616 2:240925555-240925577 GTGGGGCCCATGGCAGGTGGGGG + Intronic
1169277213 20:4241866-4241888 GTGAGAGAGAAGGCAGGAGGAGG - Intronic
1171448746 20:25222061-25222083 ATGGGATCTAAGACAGGAGGAGG + Intronic
1172651749 20:36507950-36507972 GAGGGAGCAAAGGCACGTGGAGG - Intronic
1173513706 20:43650036-43650058 GTGGGAGGAAAGGGGGGAGGGGG + Intergenic
1173821355 20:46022245-46022267 GCGGGACCAGAGTGAGGAGGTGG + Intronic
1175855430 20:62118464-62118486 GGGGGACAGGAGGCAGGAGGGGG + Intergenic
1175875656 20:62228122-62228144 GTGGGGACAGAGGGAGGAGGAGG - Intergenic
1175945674 20:62557702-62557724 GGGGCATCAAAGGCAGGAGCAGG - Intronic
1176241299 20:64077051-64077073 CTGGGTCCAGAGGCAGGAGCAGG - Intronic
1176801363 21:13433871-13433893 CTGGGGGCAAAGGCAGGTGGGGG + Intergenic
1177301891 21:19257382-19257404 GAGGGACAGGAGGCAGGAGGAGG + Intergenic
1179117381 21:38506652-38506674 GTAGAAGCAAAGGCAGGAAGAGG - Intronic
1179571096 21:42279358-42279380 GGGGGAGCAGACGCAGGAGGCGG + Intronic
1180978973 22:19869778-19869800 GTGGAGCCACCGGCAGGAGGTGG - Intergenic
1181312655 22:21953522-21953544 GTGGGCCCAATGGCATCAGGAGG - Intergenic
1181469188 22:23127497-23127519 GTGGCATCAAGGGGAGGAGGAGG + Intronic
1181559876 22:23693895-23693917 GTGGTCCCCGAGGCAGGAGGTGG - Exonic
1181582057 22:23834025-23834047 GTGGGAACAGAGGCAGGATGTGG - Intronic
1181630388 22:24148060-24148082 TTGGGACCAAAAGGAGGAGGGGG + Intronic
1182298970 22:29327468-29327490 GTGGGATCAATGGCAGGAGAGGG + Intergenic
1182432924 22:30311208-30311230 GAGAAACCAAAGGCAGGAGAGGG + Intronic
1182457080 22:30458655-30458677 CTGGGATTATAGGCAGGAGGCGG + Intronic
1182480712 22:30607062-30607084 TAGGGAACAAAGGGAGGAGGAGG - Exonic
1183064430 22:35353437-35353459 GTGGGACCAATGGGTGGAGGCGG + Intergenic
1183971347 22:41479916-41479938 TGGGTACCAAAGGCAGCAGGGGG - Intronic
1184330037 22:43821525-43821547 GTGGGGGCAATGGCAGGAAGTGG + Intergenic
1184333418 22:43840065-43840087 GTGAGACCAAGGGGAGGAGTGGG + Intronic
1184583284 22:45431078-45431100 GTGGGACCAGGGCCAGGTGGGGG + Intronic
1184638734 22:45857243-45857265 GTGGGGCCCAGAGCAGGAGGAGG - Intergenic
1184718115 22:46293428-46293450 CTGCGTCCAAAGGCAGCAGGTGG - Exonic
1184773156 22:46609766-46609788 GTGGGGCCCCAGGCAGGAGGCGG + Intronic
1184856393 22:47148872-47148894 GCGGGAGCACAGCCAGGAGGTGG - Intronic
1185231484 22:49686645-49686667 GTTGCTCCCAAGGCAGGAGGGGG - Intergenic
1185408811 22:50672393-50672415 CTGGGAGCAAAGGCAGGTGGAGG + Intergenic
949585010 3:5428695-5428717 CTGGGACAAAAGGGAGGAGCTGG - Intergenic
950070856 3:10151221-10151243 GTAGGACCAGAGGCTGGAGGTGG - Exonic
951481861 3:23169692-23169714 GTGGGAGCACAGGCAGGGGTGGG + Intergenic
951519686 3:23599714-23599736 GGGGGTCCACAGGCAAGAGGAGG + Intergenic
952255102 3:31688203-31688225 GTGAGACCAGAGGGAGGTGGGGG - Intronic
953316477 3:41931894-41931916 GTGGCAGCAGAGGAAGGAGGAGG - Exonic
953759418 3:45674890-45674912 TTGGGACAAAGGGCAGGAAGGGG - Intronic
954218560 3:49138180-49138202 GTGGGAGCAGAGCCAGGAGTTGG + Intergenic
954842367 3:53523172-53523194 GTGGGGCAAGAGGCAGGAGTTGG + Intronic
955002463 3:54939804-54939826 GTGGGCCGAAGGGCAGGAGCAGG - Intronic
955945726 3:64191828-64191850 GTGGGAGCCATGGCATGAGGAGG - Intronic
957677879 3:83393684-83393706 GTTGGCCCACAGCCAGGAGGTGG - Intergenic
958749917 3:98183475-98183497 GTGGGCCCCAAGCAAGGAGGAGG - Intronic
959860767 3:111212407-111212429 GGGGGATCAAAAGCAGGAGATGG - Intronic
960376639 3:116910398-116910420 GTGGGGCAAAAGGCAGGATAGGG - Intronic
960519712 3:118640846-118640868 TGGGGTCCAAAGGCAGGAGGTGG + Intergenic
960536716 3:118823327-118823349 GTTGGACAAGAGGCAGGGGGAGG + Intergenic
961127696 3:124435349-124435371 GTGGGAGAAAAGGCAGGAGCTGG + Intronic
962256501 3:133873399-133873421 GGGGGAAAAAAAGCAGGAGGAGG - Intronic
962763892 3:138543325-138543347 GGGGGAACCAAGGCAGTAGGGGG + Intronic
962878205 3:139552235-139552257 GGGGGACCAGAGTTAGGAGGGGG + Intergenic
962992155 3:140587903-140587925 GTGGGAACACAGGCAGGGGCTGG + Intergenic
965061690 3:163791893-163791915 GTTGGTCTAAAGGCAGAAGGTGG + Intergenic
966918144 3:184596054-184596076 GTGGGAGCAAGGACAGCAGGTGG - Intronic
967929568 3:194681005-194681027 CCGGGACAAATGGCAGGAGGAGG + Intergenic
968134490 3:196211252-196211274 GTGGGACCAGAGGCAGGGGATGG + Exonic
968616654 4:1580575-1580597 GTGGGGCCCGAGGTAGGAGGCGG - Intergenic
968900435 4:3429004-3429026 GTGGGGCCATAGGGAGGAGCTGG - Intronic
968920282 4:3518832-3518854 GTGGGGCAGAGGGCAGGAGGGGG + Intronic
969330030 4:6469269-6469291 GTGGTGAGAAAGGCAGGAGGTGG + Intronic
969373042 4:6746403-6746425 GGAGGGGCAAAGGCAGGAGGGGG - Intergenic
969532009 4:7735344-7735366 GTGGGACCGGGAGCAGGAGGAGG - Intronic
969712185 4:8850633-8850655 GTGTGAACACAGGTAGGAGGTGG - Intronic
970215785 4:13758768-13758790 GTTGGCCCCAAGCCAGGAGGTGG + Intergenic
972352002 4:38244566-38244588 GTGGAAGCAAGGGAAGGAGGAGG - Intergenic
973131405 4:46653088-46653110 GTGGGAGCAAGGGAAGGAGTGGG + Intergenic
973613075 4:52656211-52656233 CTGGGACCAAAGTTAGGAGCGGG + Intronic
975327503 4:73076761-73076783 GTGGTACCAAAGGCAGGTTTGGG - Intronic
976431465 4:84966773-84966795 GAGGAAGGAAAGGCAGGAGGGGG - Intergenic
976789275 4:88859437-88859459 GTGGGCCCAGAGGCAGGTGGTGG + Intronic
977861526 4:101966677-101966699 TTGGGAGCCAAGGCATGAGGTGG - Intronic
978468660 4:109037370-109037392 ATGGATCCAAAGCCAGGAGGAGG + Intronic
981487740 4:145304995-145305017 GGGGAACCAAAGGAAAGAGGTGG + Intergenic
982090329 4:151875042-151875064 GTGTGAGCAAAGACTGGAGGAGG + Intergenic
984030528 4:174598706-174598728 TTGTTACCACAGGCAGGAGGAGG - Intergenic
985212832 4:187613417-187613439 GTGGAAGAAAAAGCAGGAGGAGG - Intergenic
985774848 5:1835666-1835688 GTGTGACCAAAGGCAGGACACGG - Intergenic
985877762 5:2613249-2613271 CTGGGAGCCGAGGCAGGAGGGGG - Intergenic
986251235 5:6060297-6060319 GTGGGACAATAGGAAGCAGGAGG + Intergenic
986344485 5:6822233-6822255 GTGGGAGCAGAGCCAGGAGCTGG + Intergenic
986830815 5:11575761-11575783 GTGGGAAAGAAAGCAGGAGGTGG - Intronic
986892607 5:12327490-12327512 GTGGAACTTAAGGCAGGAGTGGG + Intergenic
988996737 5:36722223-36722245 GTGGGACCAGGGTCAGAAGGAGG - Intergenic
989574203 5:42974164-42974186 ATGGGACCAAAGCCAGGTAGGGG - Intergenic
990309491 5:54524355-54524377 GTGGGACCGAAGGGAGGCAGAGG + Intronic
990369403 5:55102079-55102101 GTGGGAACATGGGCTGGAGGAGG - Intergenic
992632700 5:78697344-78697366 CTGGGAGCCAAGGCAGGAGAAGG + Intronic
992665150 5:79001078-79001100 GAGTAACCAAAGGCAGGATGAGG - Intronic
993203361 5:84847317-84847339 GTGGGATCTAAAGCAGGAGAAGG + Intergenic
997631442 5:135372163-135372185 GAGGGACCCAAGGCACCAGGAGG + Intronic
997733740 5:136198742-136198764 TTGGGACCAAAGGCTGGGAGAGG - Intergenic
998002155 5:138633884-138633906 ATGGGAACAAAGGCAGCAGAAGG + Intronic
998171056 5:139872229-139872251 TGGGGAACAAACGCAGGAGGCGG + Intronic
998252766 5:140563883-140563905 GGGGGACCACAGTCTGGAGGTGG - Exonic
998529485 5:142871656-142871678 GTGGGCAGGAAGGCAGGAGGAGG - Intronic
999431321 5:151527812-151527834 GTGAGGCCAGAGGCAGGAGAGGG - Intronic
1001398165 5:171431395-171431417 ATGAGACCGAAGGCAGAAGGTGG + Intronic
1001646849 5:173288535-173288557 GTGGGTGCAAAGGCGGGAGGTGG + Intergenic
1002279702 5:178123126-178123148 GAGAGACCAAAGGCAGGTGTGGG - Exonic
1002715753 5:181225870-181225892 GTGGGACCAGGAGGAGGAGGGGG + Intronic
1002985969 6:2191026-2191048 GGGGGACCCAGGGCGGGAGGGGG + Intronic
1003529768 6:6927960-6927982 GTGGGACCCATGGAAGGACGGGG + Intergenic
1003838419 6:10095173-10095195 GTGGGCCCAGAGGGAGGAAGGGG + Intronic
1004594865 6:17089888-17089910 GTGGGGGCAAGGGCAGGAGGTGG - Intergenic
1005589465 6:27309835-27309857 GTGGCACCAAATGCAGGCTGGGG + Exonic
1005646920 6:27848266-27848288 GTAGGAGAAAAAGCAGGAGGAGG - Intronic
1005808989 6:29502137-29502159 GCATGACCAAAGGGAGGAGGGGG + Intergenic
1006228064 6:32557699-32557721 GTGGGAGGGGAGGCAGGAGGGGG - Intronic
1006230655 6:32583848-32583870 GTGGGAGGGGAGGCAGGAGGGGG - Intronic
1006424047 6:33952859-33952881 GTGGAAGCTGAGGCAGGAGGAGG - Intergenic
1006435162 6:34022298-34022320 GTGGGACCCAAGAAAGCAGGAGG + Exonic
1006866604 6:37213742-37213764 GGGGGACCTAAGGCTGGAGTAGG + Intronic
1006916069 6:37594617-37594639 GTGGGACCGGGGGAAGGAGGTGG - Intergenic
1007168651 6:39847033-39847055 GTGGGTCCTGAGGCAGGAGCAGG + Intronic
1008624305 6:53302429-53302451 GTGGCAACAACGGAAGGAGGTGG + Intronic
1009798699 6:68504687-68504709 GTGGGAGCTAAGCCATGAGGAGG + Intergenic
1010804877 6:80223851-80223873 GTGGTGCCAAAGGGTGGAGGGGG + Intronic
1012960856 6:105620291-105620313 GGAGGAGCAAATGCAGGAGGAGG - Intergenic
1015785030 6:136914694-136914716 GTGGAACCAAAGACAGAAAGTGG + Intergenic
1017055394 6:150431434-150431456 GTAGAACCAGAAGCAGGAGGGGG + Intergenic
1017060917 6:150484234-150484256 ATGGGGCCAAAGGCAGGACTGGG - Intergenic
1018798736 6:167206870-167206892 GAGGATCCAAAGACAGGAGGAGG + Intergenic
1019279691 7:193492-193514 GTGGGACGAGAGGTTGGAGGAGG - Exonic
1020116366 7:5478552-5478574 CTGGGAGCACAGGCAGGAGGGGG + Intronic
1020158410 7:5747336-5747358 GTGGGACCAGGGGAAGGAGAGGG + Intronic
1021274274 7:18629971-18629993 GTGGGACTTATGGCAGGAGGGGG + Intronic
1022114237 7:27248586-27248608 GTGGAACCCAAGGAGGGAGGAGG - Intergenic
1023850214 7:44146140-44146162 GAGGGCCCAAGGGGAGGAGGCGG - Intronic
1023871769 7:44267088-44267110 GTGGGACAGAAGGCAGGAGCTGG + Intronic
1024223458 7:47305495-47305517 TAGGGACCAAAGGAAGGTGGAGG - Intronic
1025233886 7:57220628-57220650 GTGGAGACAAAGGTAGGAGGCGG + Intergenic
1026929362 7:74215347-74215369 GGGGACCCCAAGGCAGGAGGTGG + Intronic
1026959116 7:74397375-74397397 CTAGGACCACAGGCAGGTGGAGG + Intronic
1028640727 7:93039633-93039655 GTGGGGGCCAAGGCAGCAGGGGG - Intergenic
1028724210 7:94069354-94069376 GTGGGAGCATATGCAGTAGGGGG - Intergenic
1028928379 7:96385832-96385854 CTGGGACCTAGGGCAGGAGGAGG - Intergenic
1029600936 7:101563146-101563168 GTGTGAGCAAAGGCTGGGGGCGG + Intergenic
1030227344 7:107168554-107168576 CTGGGACAAAAGGGAGGGGGCGG - Intergenic
1030820044 7:114084272-114084294 GTGGGAGCAGAGACAGAAGGAGG - Intergenic
1031037791 7:116807174-116807196 GAGAGACAAAAGGCAGGGGGAGG + Intergenic
1032479504 7:132235185-132235207 GTGGGAGCAGAGGCTGGAGTTGG - Intronic
1032516389 7:132509181-132509203 GAGGGAGGAAGGGCAGGAGGCGG + Intronic
1032878547 7:136064224-136064246 CTGGGACCACAGGAAGGAGGGGG + Intergenic
1033460389 7:141542130-141542152 GTGGCAGCAAAGGGAGGAGGAGG + Intergenic
1034431482 7:151043398-151043420 GGGGGGTCAGAGGCAGGAGGAGG + Intronic
1034431557 7:151043709-151043731 GGGGGGTCAGAGGCAGGAGGAGG + Intronic
1034431583 7:151043786-151043808 GGGGGGTCAGAGGCAGGAGGAGG + Intronic
1034501517 7:151453673-151453695 GGCAGAGCAAAGGCAGGAGGAGG + Intergenic
1035045124 7:155960493-155960515 GTGGGACCAACGGCAGGTAGGGG - Intergenic
1035732771 8:1864563-1864585 GAGGGACCCGAGGCAGGAGGTGG - Intronic
1038441773 8:27575655-27575677 GAGGGACAAATGCCAGGAGGAGG - Intergenic
1038663552 8:29517964-29517986 GTGGGACAAAATGAATGAGGTGG + Intergenic
1038781081 8:30568953-30568975 GAAGGAACATAGGCAGGAGGAGG - Intronic
1039421928 8:37450548-37450570 GTGGGAGAAAAGGAAGGAGCTGG + Intergenic
1040072035 8:43196384-43196406 GTGGAACCAGAGGCAGGGTGGGG - Intronic
1040471573 8:47738686-47738708 GTGGGACCAGATGCGGGAAGAGG + Exonic
1040914494 8:52555232-52555254 GTGGGATCATGGGCAGGAAGAGG + Intronic
1041219437 8:55634024-55634046 ATGGGGCCAAAGGGAGGATGGGG - Intergenic
1041343337 8:56869325-56869347 GAGAGACTGAAGGCAGGAGGAGG - Intergenic
1041928879 8:63266236-63266258 ATGGGAACAAAGGAAGGAGGGGG - Intergenic
1042185675 8:66134456-66134478 CTGGGGCCAGAGGCTGGAGGGGG + Intronic
1042831211 8:73030880-73030902 GTGGAACCATGGGGAGGAGGTGG + Intronic
1043178772 8:77057236-77057258 GTGGGCCAAAACTCAGGAGGGGG - Intergenic
1043821656 8:84873809-84873831 GTGGCAGCAAAGGCAGGAGTTGG - Intronic
1044533766 8:93337147-93337169 GTGGGAGTAAAGGAAGCAGGAGG - Intergenic
1044742158 8:95338914-95338936 GTAGGGCCAAATGCAGGATGAGG + Intergenic
1045502477 8:102754054-102754076 GAGGGAGCAAAGTCAGGTGGTGG + Intergenic
1045714347 8:105024347-105024369 GGGGGAAAAAAGGCATGAGGAGG - Intronic
1046651427 8:116840515-116840537 GTAGGACCAAAGGTAGAGGGGGG - Intronic
1046780052 8:118205145-118205167 TTGAGTCCAAAGGCAGGAGATGG - Intronic
1046819044 8:118616637-118616659 GTGGGACCCAAAGGAAGAGGTGG - Intronic
1047122523 8:121921971-121921993 GTGTGTCATAAGGCAGGAGGAGG - Intergenic
1048007677 8:130432138-130432160 GGGGGAACAGAGGCAGGAGGAGG + Intronic
1048567670 8:135620204-135620226 CTGGGACCACAGGCACGAGACGG + Intronic
1048590576 8:135817371-135817393 GTGGGACCAGGAGCAGTAGGAGG - Intergenic
1048831087 8:138478201-138478223 GTGTGACTAGTGGCAGGAGGTGG - Intronic
1049096628 8:140552007-140552029 ATGGGAGCTAAGCCAGGAGGAGG + Intronic
1049133130 8:140867241-140867263 TGGGGACCAAAGGAAGAAGGAGG + Intronic
1049356959 8:142193756-142193778 GTGTGACCTAGGGCAGGAGACGG - Intergenic
1049595113 8:143479802-143479824 GGGGGACAAAGGCCAGGAGGGGG + Intronic
1049654912 8:143793174-143793196 TGGGGATCAAAGGCAGGCGGGGG - Intronic
1049786917 8:144455463-144455485 GGTGGACTACAGGCAGGAGGGGG + Intronic
1053123823 9:35563900-35563922 GTGGGGCTAGAGGAAGGAGGCGG + Intergenic
1055373319 9:75623985-75624007 TGTGGGCCAAAGGCAGGAGGGGG + Intergenic
1055423311 9:76166759-76166781 GTGGGACTTAAGGAAGGAAGTGG + Intronic
1057251572 9:93507593-93507615 CTGGGGCCAGATGCAGGAGGTGG + Intronic
1058091855 9:100814183-100814205 GAGGGAGCCAAGGCAGCAGGGGG - Intergenic
1058672429 9:107371295-107371317 GTGGGACCAAAGAAGAGAGGTGG + Intergenic
1058756170 9:108084819-108084841 GTGGGTGGTAAGGCAGGAGGTGG + Intergenic
1058925268 9:109656892-109656914 GTGAGACCAGAGGCTTGAGGAGG - Intronic
1060268412 9:122125594-122125616 GTGGGGCCCCAGGCAGGACGGGG + Intergenic
1060341797 9:122783702-122783724 GTGGGAACAAAGGGAGAGGGTGG + Intergenic
1061052459 9:128204460-128204482 GTGGGATCAGAGGCGGGAGGGGG - Intronic
1061224460 9:129272688-129272710 CTGGGACCCAAAGCATGAGGAGG - Intergenic
1061533035 9:131229712-131229734 ATGAGGCCCAAGGCAGGAGGAGG + Intronic
1061762236 9:132858778-132858800 GGGGGACCAGAGACAAGAGGAGG + Intronic
1062074610 9:134578813-134578835 GAGGAACCAAAGGGAGGAGATGG + Intergenic
1062345824 9:136114735-136114757 GTGGGACGGGAGGCGGGAGGGGG - Exonic
1062445416 9:136591901-136591923 CTGGGACCACAGGCAGGAGATGG - Intergenic
1062498122 9:136841109-136841131 GTGAGCCCGAAGGCAGGAGCCGG + Exonic
1062504363 9:136865772-136865794 GTGAGGACAGAGGCAGGAGGTGG - Intronic
1062630360 9:137460545-137460567 GTGGGACCACAGGGAGGGAGTGG + Intronic
1062710972 9:137975028-137975050 GTGAGGCCACAGGCAGCAGGAGG - Intronic
1185734144 X:2484808-2484830 GTCGGAACAAAAGCAGGAGCTGG + Intronic
1186377848 X:9026373-9026395 GTGGGAGGAAAGACAGAAGGCGG + Intronic
1187266477 X:17738196-17738218 TTGGGAGCAGAGGCGGGAGGCGG + Intronic
1187280802 X:17857468-17857490 GAGGGACCAAAGGCTGGGTGAGG - Intronic
1187415811 X:19092484-19092506 GCAGGGTCAAAGGCAGGAGGGGG + Intronic
1187425870 X:19176765-19176787 GTGGGACCTAAGGCAGAGGGTGG - Intergenic
1192342924 X:70278819-70278841 GTGGGACCAACGGCAGGCTTAGG + Intronic
1192852816 X:74975665-74975687 GTGGGAACTAAGGCTGGATGTGG - Intergenic
1195687133 X:107597478-107597500 GCGGGAACAAAGGAAGGAGCAGG + Exonic
1195703812 X:107724218-107724240 GTGGGGGCAGTGGCAGGAGGAGG + Intronic
1195804123 X:108743455-108743477 ATGGAACTAAAGACAGGAGGGGG - Intergenic
1195954945 X:110318430-110318452 GTGGGAGCAAAGGGAGAAGGTGG + Intronic
1197226978 X:123963264-123963286 TTAGGAGCAAAAGCAGGAGGCGG + Intronic
1197608998 X:128617309-128617331 GTGGGAGCAAGGGGAGGGGGAGG + Intergenic
1198522832 X:137470231-137470253 TTGTGTCCAAAGGCAGGAGGAGG + Intergenic
1199903509 X:152201277-152201299 CTGGGACAAAAGGGTGGAGGTGG - Intronic
1201714626 Y:17030882-17030904 GTGGGACCAAGAGCAAGAGAGGG - Intergenic