ID: 900414870

View in Genome Browser
Species Human (GRCh38)
Location 1:2530314-2530336
Sequence GGCCGCGGCGCCCGGACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 343}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900414870_900414878 5 Left 900414870 1:2530314-2530336 CCTGGAGTCCGGGCGCCGCGGCC 0: 1
1: 0
2: 5
3: 32
4: 343
Right 900414878 1:2530342-2530364 CACACTCCGCGGCCAATGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 87
900414870_900414884 21 Left 900414870 1:2530314-2530336 CCTGGAGTCCGGGCGCCGCGGCC 0: 1
1: 0
2: 5
3: 32
4: 343
Right 900414884 1:2530358-2530380 TGGCCGGGCGGGCCGCACAAAGG 0: 1
1: 1
2: 0
3: 4
4: 58
900414870_900414875 1 Left 900414870 1:2530314-2530336 CCTGGAGTCCGGGCGCCGCGGCC 0: 1
1: 0
2: 5
3: 32
4: 343
Right 900414875 1:2530338-2530360 TTCCCACACTCCGCGGCCAATGG 0: 1
1: 0
2: 0
3: 1
4: 62
900414870_900414881 10 Left 900414870 1:2530314-2530336 CCTGGAGTCCGGGCGCCGCGGCC 0: 1
1: 0
2: 5
3: 32
4: 343
Right 900414881 1:2530347-2530369 TCCGCGGCCAATGGCCGGGCGGG 0: 1
1: 0
2: 1
3: 2
4: 81
900414870_900414873 -6 Left 900414870 1:2530314-2530336 CCTGGAGTCCGGGCGCCGCGGCC 0: 1
1: 0
2: 5
3: 32
4: 343
Right 900414873 1:2530331-2530353 GCGGCCGTTCCCACACTCCGCGG 0: 1
1: 0
2: 0
3: 6
4: 39
900414870_900414880 9 Left 900414870 1:2530314-2530336 CCTGGAGTCCGGGCGCCGCGGCC 0: 1
1: 0
2: 5
3: 32
4: 343
Right 900414880 1:2530346-2530368 CTCCGCGGCCAATGGCCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 64
900414870_900414879 6 Left 900414870 1:2530314-2530336 CCTGGAGTCCGGGCGCCGCGGCC 0: 1
1: 0
2: 5
3: 32
4: 343
Right 900414879 1:2530343-2530365 ACACTCCGCGGCCAATGGCCGGG 0: 1
1: 0
2: 4
3: 178
4: 395
900414870_900414886 27 Left 900414870 1:2530314-2530336 CCTGGAGTCCGGGCGCCGCGGCC 0: 1
1: 0
2: 5
3: 32
4: 343
Right 900414886 1:2530364-2530386 GGCGGGCCGCACAAAGGCGCCGG 0: 1
1: 0
2: 1
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900414870 Original CRISPR GGCCGCGGCGCCCGGACTCC AGG (reversed) Intergenic
900162908 1:1232794-1232816 GGCGGCGGCGCGCGGGCTCGCGG - Exonic
900414870 1:2530314-2530336 GGCCGCGGCGCCCGGACTCCAGG - Intergenic
900460576 1:2800623-2800645 CCCCGCGGCACCAGGACTCCAGG + Intronic
900981566 1:6048933-6048955 GGCAGAGAGGCCCGGACTCCAGG - Intronic
902301743 1:15506991-15507013 GGGTGCGGAGCCCGGACTCACGG + Exonic
902768311 1:18631244-18631266 CGCCGCGGGGCCTGGTCTCCGGG + Exonic
904037891 1:27568595-27568617 GGCCGCGCGGGCCGGGCTCCCGG + Intronic
904237275 1:29123673-29123695 GGCCGAGTCCCCAGGACTCCAGG + Intronic
904609208 1:31715782-31715804 GGAGGCGGAGCCCGGTCTCCAGG + Intergenic
904618906 1:31764008-31764030 GGCCGAGGCTCCCGCTCTCCCGG + Exonic
904701697 1:32361906-32361928 GGCGGCGGCGCCCGGCGACCCGG - Intronic
905167017 1:36088761-36088783 GTGCGCGGCGCCGCGACTCCGGG + Intergenic
905625997 1:39491177-39491199 GGCCGCGGTGGCCGGAACCCGGG + Intergenic
906318008 1:44800511-44800533 GGCCGCCGCGCCCGCTCCCCCGG + Exonic
907185069 1:52602851-52602873 GGCAGTGGTGCCCGGCCTCCCGG - Intronic
907278079 1:53327920-53327942 GGGCGCGGCGGCCGGAGCCCCGG - Exonic
907444572 1:54499530-54499552 GGCGGCGGCTGCCGGGCTCCGGG + Intergenic
908967510 1:69783469-69783491 AGCCACTGCGCCCGGCCTCCAGG - Intronic
909739273 1:79007862-79007884 AGCCACAGCCCCCGGACTCCAGG + Intergenic
910145749 1:84078176-84078198 GGTCTTCGCGCCCGGACTCCTGG + Intronic
912412204 1:109487158-109487180 GGCCACGGCTCCGGGACCCCTGG - Exonic
912682772 1:111739502-111739524 GGCCGCCCAGCCCGGCCTCCCGG - Intronic
912682972 1:111740409-111740431 GGGCGCGGAGCCCGGCGTCCAGG - Intronic
912717291 1:111991070-111991092 AGCCTCGGTGCCCGGAATCCTGG + Intergenic
915748097 1:158180857-158180879 AGCGGCGGCGCCAGGATTCCTGG + Exonic
919110894 1:193217465-193217487 GGCCACAGCGGCTGGACTCCAGG - Intronic
921909079 1:220528279-220528301 GGCGGCGGCGCCCGATCCCCCGG - Intronic
922789921 1:228305868-228305890 GGCCGTGTCCCCCAGACTCCAGG - Intronic
922950894 1:229558187-229558209 CCCCGCAGCGGCCGGACTCCCGG - Exonic
924223056 1:241897979-241898001 AGCCACGGCGCCCAGCCTCCTGG + Intergenic
1064354492 10:14604583-14604605 GGCTGCAGCGCTCGGCCTCCGGG + Intronic
1064694811 10:17954537-17954559 AGCCACGGCGCCCGGCCTCCAGG + Intronic
1065023201 10:21517337-21517359 GGCGGCGGCGCCCGGGCGCTGGG + Exonic
1065204388 10:23343848-23343870 GGCCGGGGCGCGAGGGCTCCGGG + Intronic
1067295894 10:44975090-44975112 GGGCGCGGCGCCGAGGCTCCGGG + Intronic
1069452408 10:68527821-68527843 AGCCACGGCGCCCGGCATCCAGG - Intergenic
1070140283 10:73733271-73733293 AGCGGTGGCGCCCAGACTCCGGG - Intergenic
1070329180 10:75405650-75405672 GGCCGCGGCTCCTGCACGCCAGG - Intergenic
1070584129 10:77748212-77748234 AGCCACTGCGCCCGGCCTCCTGG - Intergenic
1071676421 10:87659865-87659887 AGCAGCGGCTGCCGGACTCCCGG - Exonic
1071695283 10:87863498-87863520 TTCCGAGGCGCCCGGGCTCCCGG + Exonic
1072190368 10:93072949-93072971 GGCCTCGGAGCCAGGACTCCTGG + Intergenic
1072336556 10:94403093-94403115 GGCGGCGGCGGCGCGACTCCCGG - Exonic
1072591628 10:96832733-96832755 GGCGGCGGCGCCGGGGCGCCGGG - Intronic
1073101016 10:101006751-101006773 TGCTGAGGCGGCCGGACTCCGGG + Exonic
1073135443 10:101217678-101217700 GGCCGCGCCGTCTGGACCCCAGG + Intergenic
1073139676 10:101238889-101238911 GGCAGCGGCGCCCTCAGTCCAGG - Intergenic
1073812397 10:107164825-107164847 GGACGCGGCGCCCGGAGTCCCGG - Intergenic
1074503501 10:114045571-114045593 CGGCGCGGGGCGCGGACTCCGGG + Exonic
1076178485 10:128386990-128387012 CTCCGCGATGCCCGGACTCCTGG - Intergenic
1076574306 10:131453718-131453740 CGCCGTGCTGCCCGGACTCCCGG + Intergenic
1077121463 11:910847-910869 GGCGGCGGCGCGCGGGCGCCTGG - Intronic
1077207141 11:1350108-1350130 GGCCCTGGCGCCCTGACCCCCGG + Intergenic
1077253856 11:1572084-1572106 GGCCGGGGCGCGCGCACTGCGGG + Intergenic
1077506024 11:2930296-2930318 GGCCGCGACGCCCGCTCTCTGGG + Intergenic
1079223940 11:18588818-18588840 CGCGGCTGCGCCCGGAATCCGGG + Intergenic
1083309591 11:61777511-61777533 GGCCGCGGGGGCGGGGCTCCTGG + Intronic
1083545523 11:63546178-63546200 GGCCACGGCGCTTGGAATCCTGG + Exonic
1083623652 11:64060943-64060965 GGCGGCGGCGGCGGGGCTCCCGG + Intronic
1083996562 11:66275956-66275978 GGCCCCAGCGCCCCGACCCCGGG - Intronic
1084165543 11:67373323-67373345 GGCCCCGCCGTGCGGACTCCAGG + Intronic
1085322445 11:75583391-75583413 GGCGGCGGAGCCCGGAGCCCGGG + Intergenic
1088462293 11:110093707-110093729 GGCCGCGGGGCCGGGAAGCCCGG - Intronic
1089560357 11:119340408-119340430 GACCCCGGCGTCCGGGCTCCCGG - Exonic
1090029730 11:123196159-123196181 GGCCTGCGCGCCCGGGCTCCGGG + Intergenic
1090352877 11:126118797-126118819 GGCAGTCTCGCCCGGACTCCTGG + Intergenic
1090531749 11:127597820-127597842 AGCCACTGCGCCCGGCCTCCAGG + Intergenic
1091558652 12:1594358-1594380 GGCGGCGGCGGCCGGCCTCCGGG - Intronic
1091803098 12:3337268-3337290 GGCTGAGGCGCCCTGGCTCCTGG - Intergenic
1092861688 12:12724608-12724630 GGCAGCGTCCCCCGGCCTCCGGG - Intergenic
1094473331 12:30823145-30823167 CGCCCCGGCGCCCTGACTACCGG + Intergenic
1095440792 12:42237777-42237799 GGCCGCGGGGCCCGGGCACCGGG - Intronic
1096178686 12:49539157-49539179 GGCCGCGGGGCCTGGAGCCCGGG + Exonic
1097046290 12:56189614-56189636 CGCCGCCGCGCCCGGCCTGCCGG - Intergenic
1097115010 12:56690711-56690733 AGCCACCGCGCCCGGCCTCCAGG - Intergenic
1097190292 12:57216491-57216513 CTCCGCGGCGCCCCCACTCCAGG + Intergenic
1097981443 12:65741452-65741474 TGCCGCGGCGGCCGGAGCCCGGG + Intergenic
1098123946 12:67270143-67270165 AGGCCCGGCGCCCGGTCTCCCGG - Intronic
1102487934 12:113270762-113270784 GGCCACCGCGCCCGGCCTCTGGG + Intronic
1103400741 12:120641210-120641232 GTCCCCGGCGCTCGGCCTCCGGG + Exonic
1103692535 12:122787160-122787182 AGCCACGGCACCCGGCCTCCAGG - Intronic
1103882905 12:124180149-124180171 GGCCATGGCGCCCGGACTACAGG + Intronic
1104939029 12:132386296-132386318 GGCCGGGGCTCCAGGAATCCAGG - Intergenic
1106512152 13:30421642-30421664 GGCGGCGGGGCCCGGCCTCGAGG + Intergenic
1107604025 13:42040805-42040827 CGCCGCTGCGCCGGGGCTCCTGG - Intronic
1112054517 13:95677532-95677554 GGCCGCGGGGCCGGGACAGCGGG + Intronic
1112402123 13:99086491-99086513 GGCTGCGGCGGCCGGACTCGCGG - Intronic
1113082343 13:106533278-106533300 GCCCGCCTCTCCCGGACTCCGGG + Intronic
1113437809 13:110307060-110307082 CGCCGCGGCCCCCGCACGCCGGG - Exonic
1113992349 14:16037602-16037624 AGCCACTGCGCCTGGACTCCGGG + Intergenic
1115217438 14:31026642-31026664 GGCCGCAGCTACCGGACACCTGG + Intronic
1115235699 14:31207307-31207329 GGGCGCGGATCCCGGACGCCCGG - Exonic
1116905143 14:50396813-50396835 CGCCGCGGCGCCGTGAGTCCCGG - Intronic
1117478214 14:56118440-56118462 GGCCGCGGCGCGCGGAGCTCCGG + Exonic
1121075011 14:91060524-91060546 AGCCGCCGCACCCCGACTCCTGG - Exonic
1121342808 14:93115456-93115478 CGCCGCGCCGCCCGGCCTGCCGG + Intronic
1121595368 14:95157760-95157782 GGCCTCGGCGCGCGGGTTCCCGG - Intronic
1122545095 14:102517483-102517505 GCCCGCGGCCCGCGGACTGCGGG + Intergenic
1122985641 14:105210441-105210463 GGCCCCAGCGCCGAGACTCCTGG - Exonic
1124628830 15:31326128-31326150 AGCTGCCCCGCCCGGACTCCCGG + Intergenic
1125184118 15:36910909-36910931 GGTGGCGGCGCCTGTACTCCCGG + Intronic
1125468261 15:39976592-39976614 GGACGCCGCCCCCGGACTCCGGG + Exonic
1125535833 15:40440988-40441010 GGCGGCGGGGGCCGGGCTCCGGG - Intronic
1126109780 15:45168443-45168465 GGCCGGGGTGCCTGGACCCCAGG - Intronic
1126738145 15:51751903-51751925 GGGCGCAGCGCCTGGTCTCCCGG - Intronic
1127293734 15:57592071-57592093 GGCGGCGCCGCCAGGACGCCCGG + Exonic
1127968835 15:63943585-63943607 AGCCACTGCGCCCGGCCTCCTGG - Intronic
1129184890 15:73899971-73899993 GGGCGGGGCCCCAGGACTCCTGG - Intergenic
1130076572 15:80695226-80695248 GGGCGCGGCGCTCGGAGCCCGGG - Intronic
1132653464 16:1031780-1031802 GGCCGCTGTGCCCGCAATCCAGG - Intergenic
1133038441 16:3047067-3047089 GGAAGCCGGGCCCGGACTCCTGG + Intronic
1134902697 16:17952995-17953017 AGCCACTGCGCCCGGCCTCCAGG + Intergenic
1135382757 16:22008197-22008219 GGCAGCGGCGCGGGGACTCCGGG + Exonic
1135607327 16:23836014-23836036 GGCCGCGGCGCGCGGAGCCGGGG - Exonic
1136146692 16:28320537-28320559 GGCCGCGGCGCTCGGGCTCCAGG - Exonic
1136544927 16:30949370-30949392 AGCCGCGGTGCACGAACTCCCGG - Exonic
1137426329 16:48384703-48384725 CCCCGCGGCGCCCGGAGGCCCGG - Intronic
1137655316 16:50153818-50153840 GGCCGCGCCGCCGGGGCTGCCGG - Exonic
1139490784 16:67284906-67284928 GGGCGCGGTGCCAGGACACCTGG + Exonic
1141538378 16:84699671-84699693 GCCCGCGACTCCCGGGCTCCGGG + Intergenic
1141967355 16:87455001-87455023 AGCCACGGCGCTCGGCCTCCAGG - Intronic
1142299313 16:89247392-89247414 GCTCGGGGCGCGCGGACTCCAGG + Intergenic
1142350066 16:89575726-89575748 GGCCGCCGCGCGGGGACTGCAGG - Intergenic
1142430505 16:90023706-90023728 AGCCACCGCGCCCAGACTCCTGG - Intronic
1142579719 17:934158-934180 AGCCACCGCGCCCGGCCTCCCGG - Intronic
1143512657 17:7404964-7404986 AGCCGGGAGGCCCGGACTCCTGG - Intronic
1143633954 17:8153866-8153888 GGCCACCGCGCCCGGCCTCCAGG - Intronic
1143949319 17:10620180-10620202 AGCCGCTGCGCCTGGCCTCCAGG + Intergenic
1144021328 17:11241605-11241627 CGCCCGGGCGCCCGGAATCCCGG + Exonic
1144339994 17:14302794-14302816 GGCGGCGGTGCCCGGAGGCCCGG - Intronic
1144953165 17:19004673-19004695 GGCCGCGCCCCCCGGATCCCGGG - Intronic
1146329673 17:31917170-31917192 GGCCGAGCGGCCGGGACTCCGGG + Intergenic
1147418756 17:40311667-40311689 GGGCTGGGCGCCAGGACTCCTGG + Intronic
1147962538 17:44176960-44176982 GGCTGCGGCGCGCCGGCTCCTGG + Exonic
1147996712 17:44363629-44363651 GGCAGCGCCTCCCGGGCTCCCGG - Exonic
1148323616 17:46771442-46771464 GGCAGCGGCGCCCGGGCCCCGGG + Intronic
1148485074 17:47985602-47985624 AGCCACTGCGCCCGGCCTCCAGG - Intergenic
1149780911 17:59395791-59395813 AGCCACCGCGCCCGGACGCCTGG - Intronic
1149994637 17:61400141-61400163 GGCCCCGGCCCCCGGGCGCCTGG + Exonic
1150675747 17:67245034-67245056 GGCCGCCGCGCCCGGGGTCCGGG + Intronic
1151801997 17:76384342-76384364 GGCCGCGAGGCGCGGAGTCCCGG - Intronic
1151946275 17:77321671-77321693 AGCCACGGCGCCCGGCCTCAGGG + Intronic
1152356498 17:79810122-79810144 GGCTGCGGCGCGCGGGCCCCGGG - Intergenic
1152579653 17:81160330-81160352 GGCCGCAGCCCCCTGACCCCAGG + Intronic
1152664412 17:81559067-81559089 AGCCGTGGCGCCCGCTCTCCAGG + Exonic
1153290719 18:3499158-3499180 GGCGGCGGCGGCCGGGCTGCGGG + Exonic
1155054381 18:22171345-22171367 GGAGGCGGCGGCCGGACCCCCGG + Exonic
1155503807 18:26513370-26513392 AGCCACCGCGCCCGGCCTCCAGG + Intronic
1157338165 18:46756509-46756531 GCCCGCGGCGCCCGGTAGCCAGG - Exonic
1159045622 18:63366825-63366847 GGCCCCGGCACCCGGCCTCGCGG - Intronic
1159102358 18:63970644-63970666 GGCCCCGCCACCCGCACTCCCGG - Intronic
1159586879 18:70289651-70289673 GGGCGCGGCGCTGGGACTCGGGG + Intronic
1160322174 18:77905947-77905969 GCCCGTGGCACCTGGACTCCCGG - Intergenic
1160539692 18:79613812-79613834 GGCTGTAGCGCCCGGACCCCAGG + Intergenic
1160690920 19:460486-460508 GGCCGCCGCGAACGGGCTCCCGG + Intronic
1160853621 19:1206249-1206271 GGCCGCGGCGGGAGGCCTCCCGG + Intronic
1160862161 19:1242022-1242044 GGCCGCCGCCCCCGGAGTCCAGG + Intronic
1160863913 19:1249039-1249061 GGGAGCGCCGCCCGGAGTCCCGG - Intronic
1160873184 19:1286135-1286157 GGCCGCCGCGCTCGCTCTCCCGG - Exonic
1161175662 19:2841118-2841140 GGGCGGGGCGCCCGAACTGCGGG + Intergenic
1161497628 19:4596301-4596323 GGACCCGGCGCCCAGGCTCCAGG + Intergenic
1162019921 19:7863719-7863741 GGCTGCGGCCTCCTGACTCCGGG - Intronic
1162030931 19:7916959-7916981 GGCCCCAGCGCCCGGATTCCAGG - Intronic
1162369674 19:10271180-10271202 GCCCGCGCTGCCCGCACTCCTGG + Exonic
1162410484 19:10502602-10502624 GGCCGTGGCGCCCGTTTTCCTGG + Intronic
1162524138 19:11197635-11197657 GGCCGGGGCGCCCGGGCGGCTGG - Intronic
1162604861 19:11698858-11698880 AGCCACCGCACCCGGACTCCAGG - Intergenic
1162914264 19:13865706-13865728 GGCCCCGGCTCCGGGACTCGGGG - Intronic
1163154506 19:15432567-15432589 TGCCGCGGGGCCCGGGCTCGGGG + Intronic
1163508032 19:17719714-17719736 GGCGGCGGGACCCGGGCTCCGGG + Intronic
1165421799 19:35725728-35725750 GGCGGCAGCGCTCGCACTCCAGG - Exonic
1165533237 19:36421554-36421576 AGCCGCGGCCCGCGGGCTCCAGG - Intergenic
1165859544 19:38900100-38900122 GGCCGCTGCGTCCGGACCCAGGG - Exonic
1166126262 19:40717044-40717066 GGCTGGGGAGCCCCGACTCCCGG - Intronic
1166129366 19:40736885-40736907 GGCCACCGCGCCCGGCCTCCTGG + Intronic
1166305415 19:41934697-41934719 GGCCTGGGGGCCTGGACTCCTGG + Intergenic
1166306298 19:41938606-41938628 GGCTGGGGGGCCTGGACTCCTGG - Intergenic
1166306689 19:41939717-41939739 GGCCTGGGGGCCTGGACTCCTGG - Intergenic
1166310400 19:41959178-41959200 GGGCCGGGGGCCCGGACTCCCGG + Intronic
1166315228 19:41985726-41985748 GGCCTGGGGGCCTGGACTCCTGG + Intronic
1166388653 19:42396709-42396731 GGACTAGGGGCCCGGACTCCTGG - Intergenic
1166502584 19:43353166-43353188 GGCCTGGGGGCCTGGACTCCTGG + Intergenic
1166502613 19:43353240-43353262 GGCCTCGGGGCCTGGACTCCTGG + Intergenic
1166547040 19:43639886-43639908 GGCCTCGGCGCCCCGCCCCCGGG - Intergenic
1167327305 19:48834520-48834542 GGCCTGGGGGCCTGGACTCCTGG + Intronic
1167327331 19:48834594-48834616 GGCCTGGGGGCCTGGACTCCTGG + Intronic
1167327357 19:48834668-48834690 GGCCTGGGGGCCTGGACTCCTGG + Intronic
1167327435 19:48834889-48834911 GGCCTGGGGGCCTGGACTCCTGG + Intronic
1167327487 19:48835036-48835058 GGCCTGGGGGCCTGGACTCCTGG + Intronic
1167327538 19:48835183-48835205 GGCCTGGGGGCCTGGACTCCTGG + Intronic
1167327615 19:48835404-48835426 GGCCTGGGGGCCTGGACTCCTGG + Intronic
1167327713 19:48835697-48835719 GGCCTGGGGGCCTGGACTCCGGG + Intronic
1167489305 19:49782406-49782428 GGCCTGGGGGCCTGGACTCCTGG + Intronic
1167495946 19:49818764-49818786 GGCCTGGGGGCCTGGACTCCTGG + Intronic
1167650642 19:50726757-50726779 GGCCCCGGCTGGCGGACTCCTGG - Intergenic
1167691007 19:50983523-50983545 GGCCTGGGGGCCTGGACTCCTGG - Intronic
1167793071 19:51692584-51692606 GGGCCGGGGGCCCGGACTCCTGG + Intergenic
1168077682 19:53990371-53990393 GGCCGGGGAGCCTGGACTCCTGG - Intergenic
1168253538 19:55154908-55154930 GGGCTCGGGGCCTGGACTCCTGG + Intronic
1168266114 19:55224888-55224910 GGCCTGGGGGCCCGAACTCCTGG - Intergenic
1168277264 19:55284849-55284871 GGCCTGGGGGCCTGGACTCCTGG + Intronic
1168294779 19:55373260-55373282 GGCCTGGGGGCCTGGACTCCTGG - Intergenic
1168294912 19:55373622-55373644 GGCCTGGGAGCCTGGACTCCTGG - Intergenic
1168317115 19:55489208-55489230 GGCCCCTGGGCCCAGACTCCTGG - Intronic
1168643359 19:58044569-58044591 GGCCGCCACGCCCGGACACACGG + Intronic
924985130 2:263996-264018 GGCCGCGGCGCCCCGTCCCGAGG + Exonic
925750894 2:7090071-7090093 GGCGGCAGGGCTCGGACTCCAGG - Intergenic
926247815 2:11133559-11133581 GGCCCCGCCGCTCGGCCTCCAGG - Exonic
926687763 2:15711114-15711136 AGCCACCGCGCCCGGCCTCCAGG + Intronic
929604974 2:43227606-43227628 GGGCGCGGCGCCCCCACTGCCGG - Intergenic
929646915 2:43637332-43637354 GGCCGCAGCGCCCGATGTCCCGG - Exonic
932316897 2:70790584-70790606 CGCCGCGCCGCCCGCGCTCCTGG - Exonic
932625588 2:73293418-73293440 GACCTAGGCGCCCGGGCTCCTGG + Exonic
937091980 2:119212560-119212582 GGCTGCTGGGCCCGGACACCTGG + Intergenic
940646827 2:156400464-156400486 GGCCACAGCGGCGGGACTCCCGG - Intergenic
943624231 2:190180824-190180846 TTCGGCGGCGCCCGGGCTCCCGG - Intronic
944496090 2:200307583-200307605 GTCCGCAGCCCGCGGACTCCGGG - Intronic
944581119 2:201133643-201133665 AGCCACTGCGCCCGGCCTCCTGG - Intronic
946622126 2:221572368-221572390 GGCCGCGGGCCCCGGACTGGCGG - Intronic
947718182 2:232352181-232352203 CGGCGCGGCTCCAGGACTCCGGG - Intergenic
948676532 2:239600362-239600384 GGCCAGGGAGCCGGGACTCCAGG - Intergenic
948781255 2:240323204-240323226 GGTGGCGGAGCCTGGACTCCCGG - Intergenic
948801684 2:240436093-240436115 GGGCGCGGCGCCGGGAACCCGGG + Intronic
948801801 2:240436459-240436481 GGCCCCGGGGCTGGGACTCCCGG - Intronic
948910259 2:240999121-240999143 GGCGGCGGCGGCGGGAGTCCGGG - Intronic
1168795908 20:610087-610109 GGCCGCGCCGCGCCGCCTCCGGG + Exonic
1168965300 20:1894884-1894906 GGCCGCTGCCCCCGCCCTCCCGG - Intronic
1169193756 20:3672789-3672811 TGCCCCGGACCCCGGACTCCCGG - Exonic
1169274182 20:4221871-4221893 GGGCGCGTCGCCCGAACTCGGGG + Exonic
1169914526 20:10672903-10672925 TGCGGCGGCGCCCGGAACCCGGG - Exonic
1170756641 20:19211918-19211940 ACTCGCGGCGCCCCGACTCCAGG + Intergenic
1172028956 20:31968274-31968296 GGCGGCGGCGGCCGGGCCCCCGG + Exonic
1172094150 20:32452519-32452541 TGCTGCGGCCCCAGGACTCCTGG + Intronic
1172408156 20:34704409-34704431 GGCCGCATCGCCGGGACTCGCGG - Exonic
1172529317 20:35619130-35619152 CGCCCCCGCGCCCCGACTCCCGG + Intronic
1173605166 20:44326697-44326719 GGCCGCGGGGCCCTAACTCCCGG + Intergenic
1174345918 20:49929730-49929752 AGCCACCGCGCCCGGCCTCCTGG - Intergenic
1174816559 20:53692189-53692211 AGCCACCGCGCCCGGCCTCCAGG - Intergenic
1175098998 20:56564817-56564839 GGCCACTGTGCCCGGCCTCCTGG - Intergenic
1176029862 20:63006727-63006749 GGCCGCGCCGCCTGGGCTCGGGG + Exonic
1176551756 21:8226015-8226037 AGCCACTGCGCCTGGACTCCGGG + Intergenic
1176570665 21:8409014-8409036 AGCCACTGCGCCTGGACTCCGGG + Intergenic
1176578574 21:8453181-8453203 AGCCACTGCGCCTGGACTCCGGG + Intergenic
1178961793 21:37072866-37072888 GGTCGCGGCGCCCAGGCCCCGGG + Intronic
1179793349 21:43768225-43768247 GGCCTCTGCGCCCACACTCCAGG - Intergenic
1179926645 21:44538633-44538655 GGCTGCAGTGCCCGGACCCCAGG + Intronic
1179932355 21:44579110-44579132 GGCTGCGGTGCCCGGACCCCAGG + Intronic
1180314922 22:11269915-11269937 AGCCACTGCGCCTGGACTCCGGG - Intergenic
1180655678 22:17418861-17418883 GCCCGCGCCTCCCGGGCTCCTGG - Intronic
1180799455 22:18624981-18625003 GGCCCCAGTGCCCGGCCTCCTGG + Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1180915029 22:19479946-19479968 AGCCACGGCGGCCGGACGCCTGG - Exonic
1180962109 22:19766752-19766774 GGCCGCGGCGGCTGGACTCACGG - Exonic
1181006448 22:20016048-20016070 GGGCGCGCCACCCGGACCCCCGG - Intronic
1181222263 22:21370285-21370307 GGCCCCAGTGCCCGGCCTCCTGG - Intergenic
1181638022 22:24183278-24183300 GGCCCCAGTGCCCGGCCTCCTGG - Intronic
1181967658 22:26668171-26668193 GGCCGCATCTCCAGGACTCCTGG + Intergenic
1183524741 22:38316717-38316739 GGCCCCGGCGCCCGGACCTGGGG - Intronic
1183883547 22:40857095-40857117 GGCCGCGTCGCCAGGAAACCGGG - Exonic
1185269003 22:49919620-49919642 GGCCGGGGAGCCAGGACTCCGGG - Intronic
1185291891 22:50031441-50031463 GGCCGCTCCGCCCGCACGCCTGG + Intronic
1185420200 22:50730771-50730793 GGCCCCGCCGCCCGGGCCCCCGG - Intergenic
1203256775 22_KI270733v1_random:142935-142957 AGCCACTGCGCCTGGACTCCGGG + Intergenic
950215293 3:11154497-11154519 GGCCGCGGCGGCCAGGCTGCTGG - Intronic
951543637 3:23806123-23806145 GGCCGCGCCGCCGGGCCTCGGGG + Intronic
953925436 3:46980207-46980229 GGCCGAGGCGGCCGGACACTTGG + Intronic
954539722 3:51385400-51385422 GGCCGCAGCGCCCGGCTGCCCGG - Exonic
956153058 3:66263941-66263963 AGTCGCCGCGCCCGGCCTCCCGG + Intronic
960080207 3:113533075-113533097 GGCGGCGTCGCCCGGGCACCCGG + Exonic
962009737 3:131381651-131381673 GGTCGCGGCGCCCCGCCCCCAGG + Intronic
963081971 3:141402659-141402681 GGGCGCGGGCCCCGGAGTCCGGG - Intronic
966874525 3:184314771-184314793 GGCCGCGGGGCCAGGGCGCCGGG - Intronic
967841510 3:194008608-194008630 AGCCACGGCGCCCGGCCTGCAGG - Intergenic
967870497 3:194225297-194225319 GGCCCCGCCGCCAGGACTCAGGG + Intergenic
968047071 3:195630438-195630460 GGCCGCGGCCCAGGGACGCCTGG - Intergenic
968307578 3:197659606-197659628 GGCCGCGGCCCAGGGACGCCTGG + Intergenic
968511442 4:997549-997571 GGCCGCGGCGGCCGCACAACGGG - Intronic
968556812 4:1249714-1249736 GGCGGGGGAGCCCCGACTCCTGG + Intronic
968835774 4:2963512-2963534 GGCCGCGGCGCGTGGCCTGCTGG - Intergenic
968900982 4:3431677-3431699 GGCCACGGCCCTCGGACCCCTGG - Intronic
969394235 4:6910106-6910128 GGCCGCGGCTCCTGCACGCCAGG + Intronic
969714350 4:8861155-8861177 GGCAGCGGCGCCCGGACCCGCGG - Intronic
971457348 4:26857606-26857628 GGCAGCGGCGCGCGGCGTCCCGG + Intergenic
976601818 4:86944624-86944646 AGCCGCGGCGCCCAGCCTCGAGG + Intronic
981128499 4:141132955-141132977 CGCCGCGGGGACCGGATTCCGGG + Intronic
981842001 4:149123649-149123671 AGCCACGGTGCCCGGCCTCCTGG - Intergenic
984289859 4:177781676-177781698 GGCCGCTGTGGCCTGACTCCAGG - Intronic
984734797 4:183099165-183099187 GGTCGCGGCGCCCAGGCTGCCGG - Intergenic
985536659 5:468886-468908 AGCCACTGCGCCCGGCCTCCGGG - Intronic
986330815 5:6714632-6714654 GGCCGCGGCGCCTGGGCCCCGGG - Exonic
987772658 5:22326518-22326540 AGCCACCGCGCCCGGCCTCCAGG + Intronic
989274714 5:39574363-39574385 AGCCACCGCGCCCGGCCTCCTGG - Intergenic
992098433 5:73382548-73382570 GGCCGCGACTCCCGGTCTCCTGG - Intergenic
992105778 5:73448180-73448202 GGCGGCGGCGCTCGTACGCCGGG - Exonic
992563184 5:77972683-77972705 GGCCGCAGCGCCCCGACGCCGGG - Intergenic
995487323 5:112652095-112652117 AGCCACCGCGCCCGGCCTCCAGG + Intergenic
996442999 5:123512632-123512654 GGCCGCGGCGCCCTCCCTCCCGG + Intronic
997302169 5:132813982-132814004 GGCCGCGGCACCCGGACCAAGGG - Exonic
997980184 5:138464065-138464087 TGCCGAGGCGCCCAGACTCCGGG - Intergenic
998306107 5:141078532-141078554 AGCCACCGCGCCCGGCCTCCAGG + Intergenic
999017940 5:148128806-148128828 AGCCACCGCGCCCGGCCTCCAGG + Intronic
1002122563 5:177016735-177016757 AGCCGCCGCGCCCGGCCTACTGG - Intronic
1002600812 5:180353148-180353170 GGCTGCGGCGCCGGGACCCGCGG + Intronic
1002816541 6:686245-686267 AGCCGCCGCGCCCGGCCTCCTGG + Intronic
1002925137 6:1601664-1601686 GGTCGGGGCGCCTGGTCTCCCGG - Intergenic
1003290492 6:4775728-4775750 GGGCGCGCGGCCCGGGCTCCGGG + Intronic
1003481140 6:6534559-6534581 GGGCGCGGTGCCTGGACGCCTGG - Intergenic
1003551825 6:7107661-7107683 GGCGGCGGCGCTCGGACTGGGGG - Intronic
1004114187 6:12750071-12750093 GGGCGCGCGGCCCGGGCTCCGGG - Intronic
1005832391 6:29681139-29681161 GGCCGCGGCGCCGGGACTGCGGG - Intergenic
1006466493 6:34197689-34197711 AGCCACCGCGCCCGGCCTCCAGG + Intergenic
1007423475 6:41733561-41733583 GGCCGCGGGGCCCGGAGAGCTGG - Intronic
1012912756 6:105136706-105136728 GGCCGCAGCGCCCAGACCCGGGG + Intronic
1013272658 6:108558440-108558462 GGCCGCGGCCACCAGTCTCCAGG - Intergenic
1016994917 6:149954749-149954771 GGCAGCGGCGCACCCACTCCGGG + Intergenic
1017003692 6:150014687-150014709 GGCAGCGGCGCACCCACTCCGGG - Intergenic
1017738205 6:157381904-157381926 GGCCGCGGCGCCGCGGCTCGGGG + Exonic
1018419882 6:163631828-163631850 AGCCACGGCGCCCGGCCGCCAGG + Intergenic
1018420568 6:163637375-163637397 GGCCGAGGAGCCGGGAGTCCAGG + Intergenic
1019882941 7:3879471-3879493 GACCGCAGCACCCTGACTCCTGG + Intronic
1020204676 7:6105266-6105288 GGCCGCGGCGGGCGGGCACCGGG + Intronic
1021959919 7:25860811-25860833 GGCCGCAGCACCCGGCCTCCAGG + Intergenic
1025937351 7:66047894-66047916 AGCCACTGCGCCCGGCCTCCTGG - Intergenic
1026874292 7:73870783-73870805 AGCCACCGCGCCCGGACTCTCGG + Intergenic
1026923760 7:74174614-74174636 GGCGGCGGCGGCTGGGCTCCCGG + Intronic
1027421197 7:78019623-78019645 GGCCAGGGCGCCCGGGCTCGCGG - Exonic
1029639874 7:101814279-101814301 GGCAGCGGCGCCCCGACACTCGG - Intergenic
1030348018 7:108455507-108455529 GGGCGGGGCGCAGGGACTCCCGG + Intronic
1033756929 7:144403696-144403718 GGCCGCGGCGGCGGGAGTCCAGG - Intronic
1034342779 7:150368876-150368898 GGCCGCGGAGGCCGGCCTTCGGG + Exonic
1034445980 7:151114679-151114701 GGCCGGGGCGCACGGACCTCCGG - Intronic
1034979523 7:155467219-155467241 TGCCCCGGCGCCGGGCCTCCGGG + Intergenic
1035317013 7:158002671-158002693 GGCCCCGGCCCCAGGATTCCTGG - Intronic
1035466934 7:159085578-159085600 GGCCACCGCGCCCGGCCTCATGG + Intronic
1035751708 8:2001431-2001453 GGACGCGGCGCCCGCGCTGCCGG - Exonic
1037799355 8:22024152-22024174 TGCCGCGGCGCCTCGCCTCCCGG + Exonic
1040076943 8:43246557-43246579 GGCCGCAGCACCGGGACTTCTGG - Intergenic
1040928906 8:52714213-52714235 GGCCGCGGCGGGCGGGCGCCCGG - Exonic
1041044461 8:53878003-53878025 GGGCGCGGCGGCCGCTCTCCAGG - Intronic
1042155585 8:65841578-65841600 GGCCGCGGCTCGGGGGCTCCGGG + Exonic
1049406202 8:142452805-142452827 GGGCGCGGAGCCCGTCCTCCGGG + Intronic
1049457565 8:142701149-142701171 GGCCGCAGCACCCTGACCCCAGG - Intronic
1049668426 8:143859067-143859089 GGCCGCAGCTCCAGGACGCCTGG - Exonic
1049668845 8:143860675-143860697 GGCCGCAGCTCCAGGACGCCTGG - Exonic
1049669260 8:143862277-143862299 GGCCGCAGCTCCAGGACGCCTGG - Exonic
1049669672 8:143863870-143863892 GGCCGCAGCTCCAGGACGCCTGG - Exonic
1049670087 8:143865478-143865500 GGCCGCAGCTCCAGGACGCCTGG - Exonic
1049766638 8:144358211-144358233 GGCCGCGGCGCTGGGGCCCCGGG + Exonic
1049777627 8:144413857-144413879 GGCCGCAGGGCCCGTCCTCCAGG + Exonic
1049788474 8:144462495-144462517 GGCGGCGGGGCCTGGGCTCCCGG - Intronic
1049795739 8:144496559-144496581 GGCCCTGGGGCCAGGACTCCAGG + Exonic
1054798626 9:69325377-69325399 GGCAGCGGCGCCCGGGCCCCCGG - Intronic
1055266314 9:74498827-74498849 GGCGGCGGCGGCGGGACCCCGGG + Intronic
1056560638 9:87726411-87726433 GGCCGCGCCGCGCCGACTCAGGG + Intronic
1056643195 9:88388339-88388361 GGCCGCGCCGCCCCGGCGCCTGG - Intergenic
1056659977 9:88536108-88536130 CGCAGCGGCGCCGGGAGTCCAGG - Intronic
1057312090 9:93949022-93949044 GGCTGCGGCCCCCGGGCTCCGGG + Intergenic
1057488720 9:95506373-95506395 CGCCGCGGCGCCCGCGCCCCCGG - Intronic
1057771367 9:97970995-97971017 AGCCACTGCGCCCGGCCTCCAGG - Intergenic
1059414703 9:114155725-114155747 GAGCGCGGCGCCCGGACTCCTGG + Exonic
1060849299 9:126860994-126861016 GCCAGCGGCGCCGGGACTCCAGG - Intronic
1061158361 9:128879023-128879045 AGCCACCGCGCCCGGCCTCCCGG - Intronic
1061365988 9:130172634-130172656 GGCCGCGGCCCCCGCCCCCCCGG - Exonic
1061961661 9:133991950-133991972 GGCTGGGGCGGCCGGGCTCCGGG - Intronic
1062339100 9:136086040-136086062 CTGCGTGGCGCCCGGACTCCGGG - Intronic
1062504609 9:136866533-136866555 GGCCGCGGGGCCCGGGCTCCGGG - Intronic
1062542023 9:137045793-137045815 GGCGGCGGCGCCCGGCAACCCGG + Intronic
1062549125 9:137077954-137077976 GGCTGGGGCGCCAGGACTCGGGG - Intronic
1062656242 9:137605648-137605670 GGCCTCGGAGCCGGGACTCGCGG + Exonic
1203472935 Un_GL000220v1:124639-124661 AGCCACTGCGCCTGGACTCCGGG + Intergenic
1187900907 X:24025753-24025775 GCCCGCGGCGCCCCGCGTCCCGG + Intronic
1187915727 X:24150365-24150387 CGCCGCCGCGCCGGGCCTCCGGG - Intronic
1189446562 X:41085947-41085969 GGCTGCGGCGGCCGGGCTCGGGG - Exonic
1190080598 X:47354325-47354347 AGCCACTGCGCCCGGCCTCCGGG + Intergenic
1192364002 X:70455787-70455809 GGCTGCAGCGCCTGGGCTCCTGG + Intronic
1195923220 X:110002790-110002812 GGGCGCGGCGGCCGGTCCCCGGG + Intronic
1197754023 X:129982719-129982741 GGCGGCGGCGGTCGGACTCTAGG - Intronic
1198254721 X:134914936-134914958 GCCCGCGGCGCCCGGCCCCAGGG - Intronic
1199793813 X:151177411-151177433 GGCCGCGGCGAGCGGGCTCTTGG - Intronic
1200147697 X:153935071-153935093 GGCCGCCGGGCCCGTCCTCCCGG + Exonic
1200277856 X:154751154-154751176 GGCCGCGGCGGCCGGAGGCGGGG - Intronic