ID: 900414977

View in Genome Browser
Species Human (GRCh38)
Location 1:2530693-2530715
Sequence TGTAGAATGAACAAGTGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900414971_900414977 23 Left 900414971 1:2530647-2530669 CCCACTGCTGGCTGGCAGAGGCC 0: 1
1: 0
2: 4
3: 29
4: 275
Right 900414977 1:2530693-2530715 TGTAGAATGAACAAGTGCCACGG 0: 1
1: 0
2: 1
3: 16
4: 182
900414976_900414977 2 Left 900414976 1:2530668-2530690 CCGTAGGAGCAGATAAGGGAAAA 0: 1
1: 0
2: 1
3: 19
4: 243
Right 900414977 1:2530693-2530715 TGTAGAATGAACAAGTGCCACGG 0: 1
1: 0
2: 1
3: 16
4: 182
900414972_900414977 22 Left 900414972 1:2530648-2530670 CCACTGCTGGCTGGCAGAGGCCG 0: 1
1: 0
2: 5
3: 30
4: 335
Right 900414977 1:2530693-2530715 TGTAGAATGAACAAGTGCCACGG 0: 1
1: 0
2: 1
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900414977 Original CRISPR TGTAGAATGAACAAGTGCCA CGG Intergenic
900414977 1:2530693-2530715 TGTAGAATGAACAAGTGCCACGG + Intergenic
903581931 1:24377481-24377503 TGGAGAAAGAGCATGTGCCAAGG - Intronic
907678764 1:56543786-56543808 TGAAGAATGAGCAATTGCTAAGG - Intronic
908986245 1:70026555-70026577 TGTAGTATAAATAAGTCCCAGGG - Intronic
912324451 1:108744766-108744788 AGGAGAATGACCAGGTGCCAGGG - Intergenic
916572673 1:166041024-166041046 TATAAAATGAAAAAGTTCCATGG + Intergenic
916643913 1:166763002-166763024 TATAGAATGAATGAGTGGCATGG - Intergenic
917431058 1:174969488-174969510 TGAGGAATGGACAAGTGGCAGGG + Intronic
918067323 1:181110144-181110166 TGAAGAATGAACAGAAGCCAGGG + Intergenic
920790168 1:209082518-209082540 TGTAAAATGAATAAGAGTCAAGG - Intergenic
920856051 1:209662910-209662932 TGTAGCAGGAAAAAGTGCAAAGG - Intergenic
921005850 1:211093142-211093164 TGAAGAATGAGCAAGTTCCCAGG - Intronic
921607317 1:217171046-217171068 TGTAGAATGAATAAATTCTAGGG - Intergenic
921930350 1:220749260-220749282 TGAAGGATGAGCAAGTGGCATGG + Intronic
923509019 1:234633328-234633350 GCTGGAATGAACAAGGGCCACGG + Intergenic
923776422 1:236982754-236982776 TGTACAAAGAAAAAGTGACAAGG + Intergenic
924178415 1:241416518-241416540 TGAAGTATGAACATGAGCCAGGG - Intergenic
1063771613 10:9209603-9209625 TGTAGAATGAACAAATGTGTAGG + Intergenic
1064143835 10:12811926-12811948 AGTGAAATGAACAAGAGCCAGGG - Intronic
1064788883 10:18932701-18932723 TGTACAATGAACAAATGGGATGG + Intergenic
1064839327 10:19573181-19573203 TCCAGAAGGAACACGTGCCATGG - Intronic
1065193514 10:23237596-23237618 TTAAGAAGGAACAACTGCCATGG + Intronic
1065202292 10:23324698-23324720 TCTAGAAAGAACTATTGCCATGG - Intronic
1066520165 10:36209034-36209056 TATAAAATTAACAAGTGGCAGGG - Intergenic
1067143688 10:43678056-43678078 AGTAGAATAAACAAGTGTCCTGG - Intergenic
1070601154 10:77867267-77867289 TTTAGAATGCACATGTGCCTAGG + Intronic
1071362243 10:84860325-84860347 TGTAGGATGAACAAGTCCCCAGG - Intergenic
1071706750 10:88007626-88007648 TTTAGAATGAATAAGTTCTAGGG + Intergenic
1073847194 10:107569957-107569979 TGTACACGGAACAACTGCCAGGG + Intergenic
1075556708 10:123438015-123438037 TGGGGAAGGAACAAGTGGCAAGG + Intergenic
1078640627 11:13092517-13092539 TGTAGAAAGAACCCGAGCCATGG + Intergenic
1079671977 11:23182334-23182356 TGTAGGAAGAACAAGAGCAAAGG - Intergenic
1081297435 11:41409121-41409143 TAGAAAATGAACAAGTGCAAAGG - Intronic
1082756902 11:57085768-57085790 AGAAGAATGAACAAATGCTATGG + Intergenic
1086043605 11:82507431-82507453 GGGAGAATGAACAATTGGCAGGG + Intergenic
1086228743 11:84543449-84543471 TGTAAAATAAAAATGTGCCAAGG - Intronic
1089036361 11:115397390-115397412 TGCAAAATGAACAACTTCCAAGG + Intronic
1089321328 11:117628627-117628649 TTAAGAATAAACAAGTGCTATGG - Intronic
1089357626 11:117865270-117865292 TGTAAAATGCACAGCTGCCATGG + Intronic
1091385828 12:93982-94004 TGCAGGATGAACAAGAGGCATGG - Intronic
1092021230 12:5204004-5204026 TAAAGAATGAACAAATGTCAGGG - Intergenic
1096383867 12:51181640-51181662 TTTAGAATTAATAAGTGGCAAGG - Intergenic
1100949265 12:99827432-99827454 TGTAGGATGAACAAGTGTAGAGG + Intronic
1101312691 12:103597836-103597858 TGGAAAATGAACATGTGCAAAGG + Intronic
1101364091 12:104055390-104055412 TGCAGAATGACAGAGTGCCAGGG - Intronic
1106527122 13:30550953-30550975 TCTAAAGTGAACATGTGCCAGGG - Intronic
1106876001 13:34073747-34073769 TGTAGCATTAACAAGTGAAAGGG - Intergenic
1107857612 13:44631248-44631270 TGTAAAATTAACAAGTTACATGG - Intergenic
1109168521 13:59066181-59066203 TGTTGAATGACCATTTGCCAAGG + Intergenic
1110493865 13:76142133-76142155 TGTAGAATAAAAAAGTGGAATGG + Intergenic
1111904994 13:94245108-94245130 TGTAGGATGAACAAGTCAAAAGG - Intronic
1118323614 14:64767449-64767471 TCTAGAAGGAACAAGTGTCAGGG - Intronic
1119587316 14:75848540-75848562 TGTTGAATGAACTGGTGTCAGGG + Intronic
1121657898 14:95611505-95611527 TGTAGAAAGAACCATTGACACGG - Intergenic
1122025720 14:98874429-98874451 TGCAGAATGTACAAGTAGCATGG + Intergenic
1124887268 15:33698689-33698711 TGTAGAAGGAACAGAAGCCAGGG + Intronic
1126296400 15:47141524-47141546 GGTAGAATAAATAAGTTCCAGGG + Intergenic
1126669123 15:51100364-51100386 AGTAGAATAAACTAGAGCCAAGG - Intronic
1127146293 15:56027516-56027538 AGAGGAATGAACAAGTGCAAAGG - Intergenic
1128034270 15:64509707-64509729 TGGAGAATAAACAAAAGCCATGG - Intronic
1128187345 15:65653969-65653991 TGGAGAATGAACAAGATCCTGGG + Exonic
1129706773 15:77798805-77798827 AGCAGAATGAACAAATGCCCCGG + Intronic
1131481630 15:92787287-92787309 TGTTGAATGAATGAGTGCAAAGG - Intronic
1131885413 15:96907151-96907173 TGTAAAATGAGAAAGTTCCACGG + Intergenic
1133440856 16:5819876-5819898 TGATGAATGAAAAAGTGACAGGG - Intergenic
1134844308 16:17426946-17426968 AGAAGAAGGAACAAGTGCAAGGG + Intronic
1135482242 16:22830517-22830539 TGGAGAATGAATACCTGCCAAGG + Intronic
1135683839 16:24481675-24481697 TGTAGAATGATTAAGAGCCAGGG - Intergenic
1136117201 16:28102009-28102031 TGTCAGAAGAACAAGTGCCAGGG + Intronic
1140575263 16:76160397-76160419 TGTAGAAGGTAGAAGTGGCAAGG - Intergenic
1144783304 17:17818492-17818514 GGTAGAAGGAACAAGTGCAAAGG - Intronic
1146288023 17:31587582-31587604 TGTTGAATGAACAAATGCAGTGG + Intergenic
1149544698 17:57494765-57494787 TGCTGAATGACCACGTGCCATGG - Intronic
1150118358 17:62575985-62576007 TCAAGAATGAACAAGTGGCCAGG - Intronic
1150657109 17:67046516-67046538 TGTAGAAACACCAAGTCCCAGGG + Intronic
1150862479 17:68815692-68815714 GGTAGAATAAATAAATGCCATGG - Intergenic
1153958178 18:10116273-10116295 CATAAAATGAACATGTGCCAAGG + Intergenic
1155711861 18:28891010-28891032 TGCTGAAGGAGCAAGTGCCAAGG + Intergenic
1157988484 18:52467108-52467130 TGTAGAGTATACATGTGCCATGG + Intronic
1159002662 18:62987742-62987764 TGTGGAAGGGACAAGTGCAAGGG - Intergenic
1159202097 18:65200541-65200563 GGAAAAATGAACAAGTGCCTGGG - Intergenic
1159627236 18:70708971-70708993 TGTAGACTGGACTTGTGCCATGG + Intergenic
1166022627 19:40046313-40046335 GGTGTAATGAACAAGTGTCAGGG - Intronic
1166690085 19:44817288-44817310 AGTAGAGTGAGCAAGTGCAAAGG + Intronic
925218055 2:2114300-2114322 TGTAGGAAAAACAAGTCCCAAGG + Intronic
926014864 2:9441955-9441977 TGTAGAAGGGACACTTGCCAAGG + Exonic
927012744 2:18922835-18922857 TGTTGAACGAACAAAGGCCACGG - Intergenic
932623222 2:73278954-73278976 TGTAGAATGAATGAATGGCAAGG + Intronic
937661081 2:124430265-124430287 TATATAGTGAGCAAGTGCCAGGG - Intronic
938877773 2:135551421-135551443 AGTAGAATGAAAAACTGCCAAGG + Intronic
940983248 2:160025915-160025937 TGTAGGATGAACAAGTCTGAAGG + Intronic
942520075 2:176794574-176794596 GGCAGAAGGAACAAGTGCGAAGG - Intergenic
943670509 2:190655317-190655339 TGTAGCTTGGACAAGAGCCATGG - Intronic
944322249 2:198360572-198360594 TAAAGAATGAATAAGTGCAATGG - Intronic
944605856 2:201350946-201350968 GGGACAGTGAACAAGTGCCAGGG - Intronic
945233595 2:207613979-207614001 AGTAGAATTAACCAGTGACACGG + Intronic
945450642 2:209991355-209991377 TGCAGAATGAAAAAGGACCATGG + Intronic
945686669 2:212979368-212979390 TGTATAAGGAACAAGGGTCAAGG + Intergenic
945925092 2:215795136-215795158 TGGTGAATGAATAATTGCCAGGG + Intergenic
947050197 2:226033211-226033233 TGTAAAATTTACAAGTCCCAAGG - Intergenic
947717540 2:232349449-232349471 GGGTGAATGAACAAGTGACAGGG + Intergenic
1171961399 20:31497417-31497439 TGTATACTGAACAAGAGCCTTGG - Intergenic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1174096137 20:48091115-48091137 TGTGTATTGAACATGTGCCATGG - Intergenic
1174936208 20:54872702-54872724 TGAAGAAAGAACAAGTAACAGGG - Intergenic
1175722541 20:61295925-61295947 TGTAGAGTGAGAAAGTGCCATGG + Intronic
1182714310 22:32343226-32343248 TTTAGAATGAATGTGTGCCACGG + Intergenic
1183143592 22:35968666-35968688 TGTTGAATGAATGAATGCCATGG - Intronic
1185009375 22:48304752-48304774 TCTTGGCTGAACAAGTGCCAGGG + Intergenic
949824712 3:8153495-8153517 CGTGGAATTAACAACTGCCAGGG - Intergenic
951682621 3:25310363-25310385 TGTTGAATGAATGAGTGCCTAGG - Intronic
951882092 3:27489415-27489437 TGTTGAATGAATAAGTGCTAAGG + Intergenic
955576418 3:60369270-60369292 TCTAGGATCAAAAAGTGCCATGG - Intronic
958444017 3:94193232-94193254 TATAGAAATAACAATTGCCATGG + Intergenic
960823758 3:121761019-121761041 TGTAGAATGAATAGATGTCATGG + Intergenic
961383587 3:126511127-126511149 TGTAGAATGCAGAAGCTCCAGGG + Intronic
963521000 3:146359901-146359923 TGTAGAATGTACAAAAGGCATGG - Intergenic
963716491 3:148810072-148810094 GTCAGAAGGAACAAGTGCCAAGG + Intronic
963863574 3:150335815-150335837 TGTAAAATCAACAAATGCAATGG - Intergenic
964510590 3:157446217-157446239 TGTAGAGTGAACAACTGTCCTGG + Intronic
964546612 3:157840523-157840545 TGTCAAATGAACAATTGCTATGG + Intergenic
965221180 3:165928066-165928088 TGAAGAATGATCCAGTGCAACGG - Intergenic
965918073 3:173875234-173875256 TGTAGAAATAATAACTGCCATGG - Intronic
967778379 3:193408103-193408125 TAATGAATGAAAAAGTGCCAAGG + Intronic
968042601 3:195600554-195600576 TGTGGAATCAACAAGAGGCAAGG - Intergenic
970447270 4:16134702-16134724 TGTAGAATGGCCAAGATCCAGGG + Intergenic
971418917 4:26457832-26457854 TATAGAATAAATAAGTTCCATGG + Intergenic
973854784 4:55000428-55000450 TGTAGCAGGAACAAGTCCCAGGG - Intergenic
976397461 4:84571477-84571499 GGTAGAGAGAACAAGTGCAAAGG - Intergenic
976751501 4:88454993-88455015 TGTAGACTGGGCATGTGCCATGG - Intergenic
977150010 4:93499477-93499499 TGTAGCATGAAAAAGTGAGAAGG - Intronic
980266108 4:130518152-130518174 TGAAGAATGAACAAGTGATATGG + Intergenic
980588872 4:134856920-134856942 TGTGAAATGAGCAGGTGCCATGG - Intergenic
980921137 4:139087159-139087181 TGAAGAATCAACAAGTCTCAAGG - Intronic
981185703 4:141800175-141800197 TGTAAAATGAACTAATCCCAAGG + Intergenic
982639622 4:157941891-157941913 TGTAAAATGAACATAGGCCAAGG + Intergenic
982654340 4:158128731-158128753 TGCAGAAAGAACAAAGGCCACGG + Intronic
982813310 4:159854087-159854109 TGTACAGTAAACACGTGCCATGG - Intergenic
983105823 4:163684241-163684263 TGTAGGAAGAACATGTGGCAGGG + Intronic
984001025 4:174245191-174245213 TCTAGAATACACACGTGCCAAGG + Intronic
986129278 5:4912063-4912085 TGTGGTAGGAACAAGTGTCAGGG - Intergenic
987562944 5:19548002-19548024 TTTAGAATTAAGAAGTGACATGG + Intronic
988219094 5:28318068-28318090 TGTAGAATGAAATAATACCATGG - Intergenic
988276420 5:29087028-29087050 TGTAGAATAATCAAGGGTCAGGG - Intergenic
990550079 5:56866730-56866752 TGAAGAATGAAAAAGTGACAGGG + Intronic
995244709 5:109922561-109922583 TGAAGAATGATGCAGTGCCATGG + Intergenic
998213331 5:140218244-140218266 TGAAAAATGAACAAGAGACATGG - Intronic
998945754 5:147337796-147337818 TGTATAAAGAAAAAGTGACAAGG + Intronic
1001169299 5:169403562-169403584 TGTAGCATGTACAAGTCCAAAGG + Intergenic
1001884386 5:175275995-175276017 AGTAGAATGAACAATGGCCCTGG + Intergenic
1001974857 5:175989697-175989719 TGTAGACTGAATAAGTTCCAGGG + Intronic
1002242576 5:177854083-177854105 TGTAGACTGAATAAGTTCCAGGG - Intergenic
1002945641 6:1758646-1758668 TGGAGAATGTGCAAGTTCCAGGG + Intronic
1003310576 6:4966183-4966205 TGTACACTGAACAATTTCCATGG - Intergenic
1004956256 6:20731009-20731031 TGGAGAAACAGCAAGTGCCATGG + Intronic
1006415346 6:33900490-33900512 TGTAGAATGCATGAATGCCAGGG + Intergenic
1007221140 6:40279880-40279902 TGGAGGAAGAACAAGTGCAAGGG - Intergenic
1009337623 6:62512561-62512583 TGTAGCATGAACAGGTGCATTGG + Intergenic
1009720385 6:67461113-67461135 TGTAGAATGAACAAATAACATGG + Intergenic
1009882421 6:69584896-69584918 TGCAGAAGGAATAAATGCCAAGG - Intergenic
1014328250 6:120026999-120027021 TGTAGAAAGACCATGTGACAAGG - Intergenic
1016796306 6:148121601-148121623 TGTAGAAGAAACAAGTCCTATGG + Intergenic
1017114838 6:150966964-150966986 TGCAGGATGCACAGGTGCCAAGG + Intronic
1022436397 7:30389960-30389982 GGCAGAAGGAAGAAGTGCCAAGG - Intronic
1022754057 7:33266060-33266082 CCTAGAATGAAGAAGAGCCATGG - Intronic
1024913013 7:54467361-54467383 TTTAGCATGAGCAAGTGTCAGGG - Intergenic
1026229659 7:68471863-68471885 CGTAGCATGAACAACTGGCATGG - Intergenic
1026554193 7:71391832-71391854 TGCAGAATGTACAAGAACCATGG + Intronic
1027378047 7:77574009-77574031 TGTAAAATGAGTAAATGCCAAGG - Intronic
1031701485 7:124931559-124931581 TGTTGAATGAACAAATGCTGAGG + Intergenic
1032650452 7:133872373-133872395 TGTGTATTGAACAAGAGCCATGG + Intronic
1035014209 7:155750421-155750443 ATTAGAACAAACAAGTGCCAGGG + Intronic
1036093003 8:5689693-5689715 TGAAGAAATGACAAGTGCCATGG + Intergenic
1037483955 8:19330148-19330170 TGTAGAATGAACTACTACGAAGG + Intronic
1037526389 8:19728609-19728631 TGTGGAATGAACATGTGGCCTGG - Intronic
1038058604 8:23886715-23886737 ACTAGAATGAACCAGGGCCAAGG + Intergenic
1038208391 8:25491365-25491387 GGTACAATGAAGAAGGGCCAGGG + Intronic
1043690580 8:83146063-83146085 TGCAGAGTGAACACTTGCCAAGG - Intergenic
1044848560 8:96405961-96405983 TGTTGAATGAACAAGTGAGTGGG - Intergenic
1046387425 8:113522481-113522503 TGTGGAATTATCATGTGCCACGG + Intergenic
1047049600 8:121096217-121096239 GCTAGACTGAACAAGTGCCAAGG - Intergenic
1048197374 8:132343218-132343240 TAAAGAATGAATAAGTGACATGG - Intronic
1049084233 8:140465125-140465147 TGAAGAATGAACAGGTGAGATGG - Intergenic
1049339545 8:142104696-142104718 TGGAGGATGGACAAGTGCTAGGG + Intergenic
1049431086 8:142565305-142565327 TGAAGAATGATTCAGTGCCACGG - Intergenic
1050423752 9:5493168-5493190 TGTTGAATGAATAACTGCAAAGG - Intergenic
1051584239 9:18710250-18710272 TGTAGGATGAACAAATGCAATGG - Intronic
1051843186 9:21421558-21421580 CCTAGAATGAACAAATACCATGG + Intronic
1056620900 9:88213685-88213707 TGTAGAATGAACAAGTGGAAAGG - Intergenic
1056703099 9:88927029-88927051 TGCAGAATGAACAACTGTAAGGG + Intergenic
1058128767 9:101226133-101226155 TGCACTATGAACAAGTGTCATGG + Intronic
1058273643 9:103009093-103009115 TGGAGAAGGAACAAGTGTAAAGG - Intronic
1186529384 X:10279836-10279858 TGTAACATGACCAAGTGGCAGGG + Intergenic
1186828344 X:13364375-13364397 TGTGGCATGAACTACTGCCAAGG + Intergenic
1188899502 X:35712698-35712720 TCCAGAATGACCAGGTGCCAAGG + Intergenic
1191182408 X:57577733-57577755 TGTAGACTGAACCAGTGAAATGG + Intergenic
1193849067 X:86513558-86513580 TGAAGAATGTACAAATGCAATGG + Intronic
1194668509 X:96702474-96702496 TGTAGAAGGAAAAAGTGCTATGG + Intronic
1198731722 X:139737915-139737937 TGTAAGAAGAAGAAGTGCCAGGG - Exonic
1200019107 X:153187504-153187526 GGCAGACTGAACAGGTGCCAGGG + Intergenic