ID: 900415090

View in Genome Browser
Species Human (GRCh38)
Location 1:2531111-2531133
Sequence ACTACAGTGTCCACGCAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900415087_900415090 -2 Left 900415087 1:2531090-2531112 CCCTATCTGGCCAGGGATCTGAC No data
Right 900415090 1:2531111-2531133 ACTACAGTGTCCACGCAGCTCGG No data
900415084_900415090 3 Left 900415084 1:2531085-2531107 CCCACCCCTATCTGGCCAGGGAT No data
Right 900415090 1:2531111-2531133 ACTACAGTGTCCACGCAGCTCGG No data
900415088_900415090 -3 Left 900415088 1:2531091-2531113 CCTATCTGGCCAGGGATCTGACT No data
Right 900415090 1:2531111-2531133 ACTACAGTGTCCACGCAGCTCGG No data
900415086_900415090 -1 Left 900415086 1:2531089-2531111 CCCCTATCTGGCCAGGGATCTGA No data
Right 900415090 1:2531111-2531133 ACTACAGTGTCCACGCAGCTCGG No data
900415083_900415090 4 Left 900415083 1:2531084-2531106 CCCCACCCCTATCTGGCCAGGGA No data
Right 900415090 1:2531111-2531133 ACTACAGTGTCCACGCAGCTCGG No data
900415077_900415090 19 Left 900415077 1:2531069-2531091 CCCTCAGGGGCCTCTCCCCACCC No data
Right 900415090 1:2531111-2531133 ACTACAGTGTCCACGCAGCTCGG No data
900415078_900415090 18 Left 900415078 1:2531070-2531092 CCTCAGGGGCCTCTCCCCACCCC No data
Right 900415090 1:2531111-2531133 ACTACAGTGTCCACGCAGCTCGG No data
900415080_900415090 9 Left 900415080 1:2531079-2531101 CCTCTCCCCACCCCTATCTGGCC No data
Right 900415090 1:2531111-2531133 ACTACAGTGTCCACGCAGCTCGG No data
900415085_900415090 2 Left 900415085 1:2531086-2531108 CCACCCCTATCTGGCCAGGGATC No data
Right 900415090 1:2531111-2531133 ACTACAGTGTCCACGCAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900415090 Original CRISPR ACTACAGTGTCCACGCAGCT CGG Intergenic