ID: 900415755

View in Genome Browser
Species Human (GRCh38)
Location 1:2533846-2533868
Sequence CAGGACCTGGGGGAGTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900415747_900415755 11 Left 900415747 1:2533812-2533834 CCACTTCTAGGTCCATGCACAAG No data
Right 900415755 1:2533846-2533868 CAGGACCTGGGGGAGTTATTTGG No data
900415743_900415755 29 Left 900415743 1:2533794-2533816 CCATAGGACCCAGCAGCTCCACT No data
Right 900415755 1:2533846-2533868 CAGGACCTGGGGGAGTTATTTGG No data
900415746_900415755 20 Left 900415746 1:2533803-2533825 CCAGCAGCTCCACTTCTAGGTCC No data
Right 900415755 1:2533846-2533868 CAGGACCTGGGGGAGTTATTTGG No data
900415745_900415755 21 Left 900415745 1:2533802-2533824 CCCAGCAGCTCCACTTCTAGGTC No data
Right 900415755 1:2533846-2533868 CAGGACCTGGGGGAGTTATTTGG No data
900415749_900415755 -1 Left 900415749 1:2533824-2533846 CCATGCACAAGAGAATGGAAAGC No data
Right 900415755 1:2533846-2533868 CAGGACCTGGGGGAGTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900415755 Original CRISPR CAGGACCTGGGGGAGTTATT TGG Intergenic
No off target data available for this crispr