ID: 900417306

View in Genome Browser
Species Human (GRCh38)
Location 1:2540979-2541001
Sequence CTAATGCCGCGGGGGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900417290_900417306 17 Left 900417290 1:2540939-2540961 CCCGCCGCCGCCCTCATTCATTC No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417286_900417306 25 Left 900417286 1:2540931-2540953 CCGCGCCCCCCGCCGCCGCCCTC No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417293_900417306 10 Left 900417293 1:2540946-2540968 CCGCCCTCATTCATTCAGACTCA No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417287_900417306 20 Left 900417287 1:2540936-2540958 CCCCCCGCCGCCGCCCTCATTCA No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417282_900417306 29 Left 900417282 1:2540927-2540949 CCCCCCGCGCCCCCCGCCGCCGC No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417295_900417306 6 Left 900417295 1:2540950-2540972 CCTCATTCATTCAGACTCAGACC No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417292_900417306 13 Left 900417292 1:2540943-2540965 CCGCCGCCCTCATTCATTCAGAC No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417281_900417306 30 Left 900417281 1:2540926-2540948 CCCCCCCGCGCCCCCCGCCGCCG No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417288_900417306 19 Left 900417288 1:2540937-2540959 CCCCCGCCGCCGCCCTCATTCAT No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417285_900417306 26 Left 900417285 1:2540930-2540952 CCCGCGCCCCCCGCCGCCGCCCT No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417291_900417306 16 Left 900417291 1:2540940-2540962 CCGCCGCCGCCCTCATTCATTCA No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417294_900417306 7 Left 900417294 1:2540949-2540971 CCCTCATTCATTCAGACTCAGAC No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417283_900417306 28 Left 900417283 1:2540928-2540950 CCCCCGCGCCCCCCGCCGCCGCC No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417284_900417306 27 Left 900417284 1:2540929-2540951 CCCCGCGCCCCCCGCCGCCGCCC No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data
900417289_900417306 18 Left 900417289 1:2540938-2540960 CCCCGCCGCCGCCCTCATTCATT No data
Right 900417306 1:2540979-2541001 CTAATGCCGCGGGGGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900417306 Original CRISPR CTAATGCCGCGGGGGGGCCC AGG Intergenic
No off target data available for this crispr