ID: 900420199

View in Genome Browser
Species Human (GRCh38)
Location 1:2552976-2552998
Sequence CCTGGGTTCCAGCCCTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900420199_900420213 8 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420213 1:2553007-2553029 GCCTGGGTGGTGGGACAGAGTGG No data
900420199_900420211 -2 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420211 1:2552997-2553019 GGTGGGGGATGCCTGGGTGGTGG No data
900420199_900420206 -9 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420206 1:2552990-2553012 GAACCCAGGTGGGGGATGCCTGG No data
900420199_900420217 14 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420217 1:2553013-2553035 GTGGTGGGACAGAGTGGGGCTGG No data
900420199_900420212 -1 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420212 1:2552998-2553020 GTGGGGGATGCCTGGGTGGTGGG No data
900420199_900420218 17 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420218 1:2553016-2553038 GTGGGACAGAGTGGGGCTGGAGG No data
900420199_900420221 30 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420221 1:2553029-2553051 GGGCTGGAGGAGAGGGTCTGAGG No data
900420199_900420219 22 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420219 1:2553021-2553043 ACAGAGTGGGGCTGGAGGAGAGG No data
900420199_900420210 -5 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420210 1:2552994-2553016 CCAGGTGGGGGATGCCTGGGTGG No data
900420199_900420216 10 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420216 1:2553009-2553031 CTGGGTGGTGGGACAGAGTGGGG No data
900420199_900420220 23 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420220 1:2553022-2553044 CAGAGTGGGGCTGGAGGAGAGGG No data
900420199_900420215 9 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420215 1:2553008-2553030 CCTGGGTGGTGGGACAGAGTGGG No data
900420199_900420207 -8 Left 900420199 1:2552976-2552998 CCCTTGGAGGGCTGGAACCCAGG No data
Right 900420207 1:2552991-2553013 AACCCAGGTGGGGGATGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900420199 Original CRISPR CCTGGGTTCCAGCCCTCCAA GGG (reversed) Intergenic
No off target data available for this crispr