ID: 900421601

View in Genome Browser
Species Human (GRCh38)
Location 1:2558199-2558221
Sequence GCTGTGTCCCGTGGGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 200}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900421593_900421601 10 Left 900421593 1:2558166-2558188 CCCAGAGCAGCTCTGCTCATGGC 0: 1
1: 0
2: 3
3: 26
4: 267
Right 900421601 1:2558199-2558221 GCTGTGTCCCGTGGGGCTCATGG 0: 1
1: 0
2: 0
3: 16
4: 200
900421594_900421601 9 Left 900421594 1:2558167-2558189 CCAGAGCAGCTCTGCTCATGGCT 0: 1
1: 0
2: 1
3: 23
4: 261
Right 900421601 1:2558199-2558221 GCTGTGTCCCGTGGGGCTCATGG 0: 1
1: 0
2: 0
3: 16
4: 200
900421591_900421601 11 Left 900421591 1:2558165-2558187 CCCCAGAGCAGCTCTGCTCATGG 0: 1
1: 0
2: 3
3: 50
4: 438
Right 900421601 1:2558199-2558221 GCTGTGTCCCGTGGGGCTCATGG 0: 1
1: 0
2: 0
3: 16
4: 200
900421589_900421601 29 Left 900421589 1:2558147-2558169 CCAGAACTTTCCGATTTTCCCCA 0: 1
1: 0
2: 1
3: 38
4: 288
Right 900421601 1:2558199-2558221 GCTGTGTCCCGTGGGGCTCATGG 0: 1
1: 0
2: 0
3: 16
4: 200
900421590_900421601 19 Left 900421590 1:2558157-2558179 CCGATTTTCCCCAGAGCAGCTCT 0: 1
1: 0
2: 3
3: 38
4: 283
Right 900421601 1:2558199-2558221 GCTGTGTCCCGTGGGGCTCATGG 0: 1
1: 0
2: 0
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900421601 Original CRISPR GCTGTGTCCCGTGGGGCTCA TGG Intronic
900084848 1:887140-887162 GCTGTGGCCCATGGCTCTCATGG - Intergenic
900109025 1:997928-997950 GCTGTGTCCTGGAGGGCCCAGGG + Intergenic
900390924 1:2433441-2433463 GCTGTGGCTCTTGGGGTTCAGGG + Intronic
900421601 1:2558199-2558221 GCTGTGTCCCGTGGGGCTCATGG + Intronic
900436219 1:2632518-2632540 TGTGTGTGCCGTGGGGCACATGG - Intronic
900500360 1:3001533-3001555 GAGGTGTCCCGTGGGTCACATGG + Intergenic
900533027 1:3163968-3163990 GCTGCGTCCCCTGGGCCCCAGGG - Intronic
900707706 1:4090726-4090748 GGTGAGTCCCATGAGGCTCATGG + Intergenic
900736165 1:4300762-4300784 GCTGGGGCCCGTGAGGGTCAGGG - Intergenic
900955914 1:5886386-5886408 GATGTGGCCCATGGGGCTCTGGG + Intronic
901696092 1:11009332-11009354 GCTGTGTCCTGTTTGCCTCATGG + Intergenic
902810053 1:18883030-18883052 GCTGAGACCCAAGGGGCTCAGGG + Intronic
904410754 1:30323488-30323510 GCTGTGTGACCTTGGGCTCATGG - Intergenic
905446446 1:38030968-38030990 GGTGGGTCCTGTGGGGCTCAGGG + Intergenic
906369413 1:45240056-45240078 GCTGTGTCCCGTGCATTTCATGG - Intronic
907394230 1:54178331-54178353 CCTGTGTTCCCTGGTGCTCAGGG - Intronic
912514648 1:110210352-110210374 GCTGGGGCCCTAGGGGCTCATGG - Intergenic
913045969 1:115073727-115073749 TCTGTGTGCTGTGTGGCTCATGG + Intronic
915283402 1:154837905-154837927 GCTGTGTGCCGTGGGGAGCCAGG + Intronic
918332364 1:183472407-183472429 GCTCTGGCCCGTGGGGCGCAGGG - Intronic
920086622 1:203422205-203422227 GCTGTCTCACCTGGGGCTCAGGG - Intergenic
922672619 1:227522555-227522577 GCTGTGGCTCATGGCGCTCATGG - Intergenic
923623308 1:235594954-235594976 GCTGGGTCCCTTCAGGCTCAGGG - Intronic
923894564 1:238255013-238255035 GGTGTGTCCTGTGTGGCCCATGG + Intergenic
1063297943 10:4825742-4825764 CCTGCGTCCCCTGGGGCACAGGG - Intronic
1066746098 10:38604926-38604948 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
1067223826 10:44362833-44362855 GCTCTGAGACGTGGGGCTCACGG + Intergenic
1067697074 10:48543104-48543126 GGTGTGTCCCCTTGGGCACATGG - Intronic
1071831240 10:89374393-89374415 GCTCTGTCCTGTGTGGTTCATGG + Intronic
1073436156 10:103517415-103517437 GCTGTGGGTCTTGGGGCTCAGGG - Intronic
1075951141 10:126478812-126478834 GTTGTGTCCCCTGGGGAACAGGG + Intronic
1076398861 10:130164073-130164095 GCTGAGTCCAGTGGGGCTCCAGG - Intronic
1076697960 10:132256185-132256207 GCTGAGTCCTGTGGGGCCCCTGG + Intronic
1077072097 11:679791-679813 GATCTGTCCCGAGGGGGTCACGG + Exonic
1077577521 11:3395782-3395804 TCTGTGCCCTGGGGGGCTCAAGG + Intergenic
1078103861 11:8346285-8346307 GCAGGGTCACCTGGGGCTCACGG - Intergenic
1079499827 11:21090544-21090566 GCTGTGTGACGTTGAGCTCATGG + Intronic
1083688454 11:64391748-64391770 GCTATGTTCCTTGGAGCTCAAGG + Intergenic
1084226472 11:67717721-67717743 TCTGTGGCCTGGGGGGCTCAAGG + Intergenic
1084502581 11:69543666-69543688 GCAGAGTCCCGAGGGGCACAGGG - Intergenic
1084808720 11:71599134-71599156 TCTGTGGCCTGGGGGGCTCAAGG - Intronic
1084845825 11:71899144-71899166 TCTGTGGCCTGGGGGGCTCAAGG - Intronic
1085637407 11:78169221-78169243 CCTGTGTCCCAGGGGGCTCTGGG - Intergenic
1086443691 11:86852310-86852332 TCTATGGCCTGTGGGGCTCAGGG + Intronic
1088920440 11:114256979-114257001 GCTGTGTCCCCTGGGTCTTGAGG - Intergenic
1089000128 11:115044906-115044928 CCTGTGTCCTGTGAGGGTCAGGG + Intergenic
1090425529 11:126604620-126604642 GGTGTGTCCTGTGGGCCACATGG + Intronic
1091643947 12:2259236-2259258 GCTGGGTCCCGTGTGGGGCAGGG - Intronic
1091846061 12:3657128-3657150 GTTGTGTCCCGCTCGGCTCAGGG - Intronic
1092431222 12:8410466-8410488 TCTGTGGCCTGTGGGGCTCAAGG + Intergenic
1092434124 12:8432659-8432681 TCTGTGGCCTGTGGGGCTCAAGG + Intergenic
1096676588 12:53229662-53229684 GCTGTGGCCCAGGGGCCTCAGGG - Intronic
1101848340 12:108381914-108381936 GATTTGTTCCGTGGTGCTCAGGG - Intergenic
1101983867 12:109430478-109430500 GCTGTGTCCCCTGGGGGTGGTGG + Intronic
1104886411 12:132111841-132111863 GCTGGGTGCCGTGCGTCTCATGG + Intronic
1105121275 13:16784257-16784279 GCTTTTTCCCGTAGGCCTCAGGG - Intergenic
1106006619 13:25776123-25776145 GCTGTTTCCAGTTGGGCTCCGGG - Intronic
1106054931 13:26229086-26229108 GCTGTTTCCCATGAGTCTCAGGG - Intergenic
1112778000 13:102866460-102866482 ACTGTGCCCCCTGGTGCTCAGGG + Intronic
1113902760 13:113805788-113805810 ACTGTGTCCCCGGGGGCACACGG - Intronic
1116186637 14:41607072-41607094 GCTGTGTTCCGCGGCGCGCAGGG + Intergenic
1116264409 14:42668271-42668293 GCTGTCTGCCCTGGGGCTGAAGG - Intergenic
1117525530 14:56598742-56598764 GCTGTGTCCTGATGGGGTCACGG + Intronic
1118598464 14:67454082-67454104 GTTGTGTCCCCTGGGGGGCAGGG + Intronic
1121368063 14:93332758-93332780 GCTGTGTCCGGTGTGGCGCGGGG - Intronic
1122355531 14:101120940-101120962 ACTGTGTCCCGTGGGGGCCAGGG + Intergenic
1122536102 14:102464125-102464147 GCTGAGTCCCGACGGTCTCATGG + Intronic
1122903716 14:104792480-104792502 GCTGCCTCCCCTGGGGCTCCTGG - Intronic
1125477310 15:40055814-40055836 GCTGTGTAGCCTGGGGCTCAGGG + Intergenic
1128536105 15:68491833-68491855 CCTGTGTCCTGTGGGGGCCAGGG + Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132582725 16:693006-693028 GCGGTATCTCCTGGGGCTCAAGG + Exonic
1136736960 16:32474715-32474737 GCTGTGGCCTGAGGGGCTCCTGG + Intergenic
1138615282 16:58160558-58160580 GCTGGGTGCCGCGGGGCTCGTGG - Intronic
1142045492 16:87922617-87922639 GCTGTGTCCAGTGGGCCTTGAGG - Intronic
1142062448 16:88039354-88039376 CCTTTGTCCCGTGGTTCTCACGG + Intronic
1142350193 16:89576154-89576176 GCTGAGGCCAGTGGGGCGCAAGG + Intronic
1203016111 16_KI270728v1_random:354862-354884 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
1203034446 16_KI270728v1_random:628020-628042 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
1142755201 17:2012328-2012350 GCTGTGTTCCTTGTGGCTCCAGG - Intronic
1143513556 17:7408270-7408292 GCTGTGTCTGGTGGGGCTGGCGG + Exonic
1144677848 17:17173311-17173333 CCTGAGTGCCGTGAGGCTCATGG - Intronic
1149285482 17:55159160-55159182 CCTCTGTCCCCTGGGGTTCAAGG - Intronic
1149469459 17:56903941-56903963 GCTGTTTCCTTTGGAGCTCAGGG - Intronic
1152374781 17:79913477-79913499 GCTGGGTCCTGGGGGGCACAGGG - Intergenic
1152559933 17:81072860-81072882 GGGCTGTCCCGTGGGCCTCACGG + Intronic
1152830352 17:82493507-82493529 GCTGTGTCCAGACTGGCTCAGGG - Intergenic
1153626384 18:7025455-7025477 ACTGAGTCCCCTGGGGCCCACGG + Intronic
1155333985 18:24746350-24746372 GCTGTGACCTGTGGGGAGCAAGG + Intergenic
1157227391 18:45879759-45879781 GCAGTGTCCCATGGAGCTCTGGG - Intronic
1160237778 18:77099578-77099600 GCTGTGCCACCTGGGGCTCCAGG + Intronic
1161418483 19:4161659-4161681 GCTGTGTGACTTAGGGCTCATGG - Intronic
1162382497 19:10339760-10339782 GCTGTGGCCCTTGGGGGCCAGGG + Exonic
1162399463 19:10436022-10436044 GCTGAGTCCCTTGGGGCTGGTGG + Intronic
1162552185 19:11364102-11364124 GCTGTGGCCGGTAGGGCCCAGGG + Intronic
1162564487 19:11437776-11437798 GCTGTGTGCAGTGTGGGTCAGGG + Intronic
1163597837 19:18230832-18230854 GCTGTGTCCCCTAAGGCTGATGG - Intronic
1164656896 19:29928389-29928411 GCTGTCTCCACTGAGGCTCAGGG - Intronic
1165095105 19:33405939-33405961 GCTGCGTCCTGTGGGCCTCCTGG + Intronic
1165943640 19:39428456-39428478 GCTGTGTCCCGGGGGCCCCGTGG + Intergenic
1165950826 19:39473190-39473212 TCTGCGTCCCCAGGGGCTCACGG + Exonic
931945085 2:67297530-67297552 ACTCTGTCCCGTGGAGCCCAGGG - Intergenic
932348437 2:71011807-71011829 TCTGTGGCCTGGGGGGCTCAAGG - Intergenic
934188103 2:89763836-89763858 GCTGTGGCCTGAGGGGCTCCTGG + Intergenic
934308503 2:91844118-91844140 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
934947004 2:98549654-98549676 CCTGTGACCCATGGGGCTCAGGG + Intronic
938821648 2:134966652-134966674 TCTGTGGCCTGGGGGGCTCAAGG - Intronic
940969920 2:159884585-159884607 GCTGGGTGCTGTGGGGCACAAGG + Intronic
941691072 2:168501325-168501347 GCTGTTTCCAGTGGGGCTGGAGG + Intronic
942785265 2:179693782-179693804 ACTTTGTCCCCTGGGGCTGAAGG - Intronic
946131873 2:217612821-217612843 GCTTTGTTCCGTGGGATTCATGG - Intronic
947568308 2:231210159-231210181 GAAGTGGCCCGTGGAGCTCAAGG + Intronic
948529685 2:238596395-238596417 GCTGTGTCCAGTTGGTTTCATGG - Intergenic
948698260 2:239745008-239745030 GCTGTCTCTCATGGGCCTCACGG - Intergenic
948728185 2:239947321-239947343 GCTCTGTCCCTGGGGGCTCTGGG - Intronic
1168771189 20:417942-417964 GCTGGGTCCGGCGGTGCTCAGGG - Intronic
1169069293 20:2712856-2712878 TCTGTGTCCAGTGCTGCTCATGG + Intronic
1171901685 20:30863972-30863994 GCTGTGGCCTGTGGCTCTCATGG - Intergenic
1172282728 20:33719608-33719630 GCTAAGTCCCGTTCGGCTCAGGG - Intronic
1173856355 20:46252839-46252861 CCTGAGACCTGTGGGGCTCAGGG + Intronic
1174042673 20:47710988-47711010 GCTGTGTCTCGTGGCGACCAGGG + Intronic
1175331957 20:58171260-58171282 GCAGTGACCCGTGGCGCTGAGGG - Intergenic
1175856805 20:62125282-62125304 GCTGTGTCACGTGGCTCTTAAGG + Intronic
1175942173 20:62542433-62542455 GCAGTGCCACGTGGGCCTCAAGG + Intergenic
1176414444 21:6466910-6466932 GCGGTCTCGCCTGGGGCTCAGGG + Intergenic
1178391257 21:32200242-32200264 GCTGGGTCCAGTTTGGCTCATGG + Intergenic
1179657983 21:42857264-42857286 GGTCTGTCCCCTGGGGCTCTGGG - Intronic
1179689942 21:43075232-43075254 GCGGTCTCGCCTGGGGCTCAGGG + Intronic
1180074460 21:45455665-45455687 GCAGGGGCCCCTGGGGCTCAGGG - Exonic
1180335060 22:11569920-11569942 GCTGTGGCCTGTGGCTCTCATGG - Intergenic
1180393740 22:12309817-12309839 GCTGAGTCATGTGGGGCCCAAGG + Intergenic
1180406006 22:12554931-12554953 GCTGAGTCATGTGGGGCCCAAGG - Intergenic
1180535590 22:16391197-16391219 GCTGTGGCCTGAGGGGCTCCTGG - Intergenic
1182189320 22:28442646-28442668 GCTGTCACCCCTGGGGCTCCAGG + Intronic
1182770827 22:32795068-32795090 GCTGTGGACCGTGGGGCCCTGGG + Intronic
1183190368 22:36318578-36318600 TCTCTGCCCCGTGGGGCTCAGGG - Intronic
1183299972 22:37054092-37054114 ACTGTGTCCCATAGGGCTCAGGG - Intronic
1183933490 22:41249100-41249122 GCTGAGGACAGTGGGGCTCAGGG - Intronic
1184370863 22:44081159-44081181 TCTGTGCCCGGTGGGGCCCAAGG + Intronic
1184455932 22:44609429-44609451 TCTGTGTCCCCAGGGGCCCAAGG - Intergenic
1184790315 22:46695961-46695983 GCCGTGTCCTGTGAGTCTCAGGG + Intronic
1184813053 22:46850234-46850256 GCTGTGTGCCGTGGGGTTGTGGG + Intronic
1184856975 22:47151642-47151664 GCTTCTTCCTGTGGGGCTCAGGG + Intronic
949885915 3:8693897-8693919 TCTATGGCCCGGGGGGCTCAAGG - Intronic
950739691 3:15040472-15040494 TCTGTGTTCCATGGGGCTCCTGG - Intronic
954214597 3:49117250-49117272 GCTTAGCCCGGTGGGGCTCAGGG + Exonic
955816101 3:62845055-62845077 CCTGTGTCCAGTGGAGCTAAAGG - Intronic
956737296 3:72247556-72247578 ACTGTGGACCATGGGGCTCAGGG - Intergenic
956959044 3:74376122-74376144 GCTTTGTTCCTTGGGGCTCCAGG - Intronic
957046042 3:75375394-75375416 TCTGTGGCCTGGGGGGCTCAAGG + Intergenic
957074869 3:75593919-75593941 TCTGTGGCCTGGGGGGCTCAAGG + Intergenic
959112859 3:102142839-102142861 AATGAGTCCCATGGGGCTCAAGG + Intronic
960334147 3:116395315-116395337 GCTGTGTGCCGTGCATCTCAGGG - Intronic
961276336 3:125730212-125730234 TCTGTGGCCTGGGGGGCTCAAGG - Intergenic
961379686 3:126488818-126488840 GCTGTCTACCCAGGGGCTCACGG - Intronic
961878099 3:130039518-130039540 TCTGTGGCCTGGGGGGCTCAAGG + Intergenic
963733067 3:148991420-148991442 GCGGTGGCCCGCGGGGCTCCGGG - Exonic
966292815 3:178379994-178380016 GATGTGTTCCGTGGGGCACCAGG + Intergenic
967135809 3:186511736-186511758 GCTTCATCCCGTGGAGCTCAAGG + Intergenic
967919246 3:194602259-194602281 GCTGTGGCTCCTGGGGCACACGG + Intronic
968453674 4:686787-686809 GCTGTGTCCCCTCGGCCTCACGG - Intronic
968741843 4:2335100-2335122 GTAGGGTCCTGTGGGGCTCAAGG - Intronic
968903282 4:3440857-3440879 ACTGTGCCCCCTGGGGCCCACGG + Intergenic
968987517 4:3884575-3884597 TCTGTGGCCTGGGGGGCTCAAGG + Intergenic
968990316 4:3906554-3906576 TCTGTGGCCTGGGGGGCTCAAGG + Intergenic
969730651 4:8955339-8955361 TCTGTGGCCTGGGGGGCTCAAGG - Intergenic
969735517 4:8987161-8987183 TCTGTGGCCTGGGGGGCTCAAGG - Intergenic
969790251 4:9489452-9489474 TCTGTGTCCTGGGGGGCTCAAGG - Intergenic
971372541 4:26029958-26029980 TCTGTGCCCCGTGGGACTGAAGG + Intergenic
976712485 4:88087191-88087213 GCTATGTCTGGTGGGGTTCAAGG + Intergenic
977941155 4:102860882-102860904 GAAGTGTCCTGTAGGGCTCATGG + Intronic
983034696 4:162848949-162848971 ACTGAGTCCCTTGGGGCTCCTGG + Intergenic
986299428 5:6466413-6466435 GCTGTGGCCCGTGGGCCTCCTGG + Intronic
986547356 5:8912933-8912955 GCTGTTTCCCTTGGTGCTAATGG - Intergenic
989146082 5:38251511-38251533 GTTGTGTCCTGTGTGGTTCATGG + Intergenic
995647399 5:114328645-114328667 GCAGTTTCCCATGGGCCTCAAGG - Intergenic
1001879813 5:175233590-175233612 TATTTGTCCTGTGGGGCTCATGG - Intergenic
1004538193 6:16523281-16523303 GCTCAGTCCCCTGGGCCTCAGGG - Intronic
1004720616 6:18264769-18264791 GCTGTGTCCCGCGGGGCGGGCGG + Exonic
1005298435 6:24448715-24448737 GCTGTGGCCCGGGGGCTTCATGG - Intronic
1005716536 6:28554487-28554509 GCTGTGTGCGGTGGGGCTGTGGG + Intergenic
1006164400 6:32056137-32056159 GCTGAGTTCCGTGGGGCTGGGGG + Intronic
1006310441 6:33254507-33254529 GCAGTGTACGGTGGGGCACAGGG + Intronic
1006439475 6:34045086-34045108 GTTGTTTCCTGTGGGGCACAAGG - Intronic
1007747517 6:44051990-44052012 GCTGAGTCCCGAAGGGCCCAAGG - Intergenic
1007821737 6:44565329-44565351 GGTGTGGCCCGTGTGGCTCCGGG - Intergenic
1008545252 6:52577494-52577516 GCTGTGGCCCCGGGGGCTGAGGG + Intergenic
1014784045 6:125597726-125597748 GCCGTGTGCTGTGGGGCCCATGG - Intergenic
1014928503 6:127304170-127304192 GCTGAGCCCCGTGGAGCTGAGGG - Intronic
1016988731 6:149914246-149914268 GCTGTGTGCCAAGGAGCTCATGG + Intergenic
1017008045 6:150042146-150042168 GCTGTGTGCCAAGGAGCTCAGGG + Intergenic
1020313145 7:6884608-6884630 TCTGTGGCCTGGGGGGCTCAAGG + Intergenic
1024251107 7:47506347-47506369 GCTATGTCCTGTTGGGCTTAGGG - Intronic
1024858602 7:53811788-53811810 CCTGTGGCCCCTGGGGCTCTCGG - Intergenic
1028416064 7:90581854-90581876 TCTGTGTCCTGTGGGAATCAGGG - Intronic
1031039817 7:116827552-116827574 GCTGTGAACTGTGGTGCTCATGG - Intronic
1032668701 7:134064101-134064123 GCTCTGTCCTTTGGAGCTCATGG - Intronic
1036181412 8:6588531-6588553 GCTGTGTCCAGCCGGGCTCCTGG + Intronic
1037762687 8:21752388-21752410 GCTGTGTCCAGTGCTGCTGATGG - Intronic
1038035519 8:23683034-23683056 GCGGGGTCACCTGGGGCTCAGGG - Intergenic
1040519183 8:48160431-48160453 GCTGTGGCCCCTAGGGCCCAGGG - Intergenic
1049012479 8:139896690-139896712 TCTTTGTCCAGTGGGACTCATGG - Intronic
1049546062 8:143231598-143231620 GCTGTCTCCCCTGGTGCCCATGG - Intergenic
1050394056 9:5177114-5177136 GCTGTGATCCATGGCGCTCAGGG + Intronic
1057236599 9:93366318-93366340 GCCGGGCCCCTTGGGGCTCAAGG + Intergenic
1057382704 9:94583287-94583309 TCTGTGTCTTGTGGGGCTGAGGG - Intronic
1058869271 9:109188551-109188573 GCTGTGTTCCCTAGGGCACAGGG - Intronic
1059568610 9:115409615-115409637 GCTGTGTCCCATGGGGAAGACGG + Intergenic
1061896987 9:133653364-133653386 CCTTTGCCCCGTGGAGCTCAAGG + Intronic
1062227819 9:135463474-135463496 GCTGGGTCCCAGGGAGCTCAGGG + Intergenic
1062428683 9:136517424-136517446 GCTGTGCCCAGTGGGGCACTGGG - Intronic
1189643013 X:43094509-43094531 AATGTGTCTCGTGTGGCTCATGG - Intergenic
1193042655 X:77019950-77019972 GCTGGGTTCAGTGGGGCCCATGG - Intergenic
1198230247 X:134682430-134682452 GGTGTGTTCTGAGGGGCTCAAGG + Intronic
1199793539 X:151176046-151176068 TCTGTGTCCCGCGGGGAACAGGG - Intergenic
1201756579 Y:17493462-17493484 GCTGTGGCCCGTGGCTCTCACGG + Intergenic
1201844974 Y:18412522-18412544 GCTGTGGCCCGTGGCTCTCACGG - Intergenic