ID: 900422334

View in Genome Browser
Species Human (GRCh38)
Location 1:2560998-2561020
Sequence CACCCACAGCCCCAGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 453}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900422334_900422338 -8 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422338 1:2561013-2561035 TGTGGGTGTCCCTGAATGTCAGG 0: 1
1: 1
2: 3
3: 18
4: 236
900422334_900422355 27 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422355 1:2561048-2561070 CCCCTGGGCTTCAGGGGTTGGGG 0: 1
1: 0
2: 3
3: 30
4: 337
900422334_900422350 20 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422350 1:2561041-2561063 GGGAGGGCCCCTGGGCTTCAGGG 0: 1
1: 0
2: 2
3: 42
4: 350
900422334_900422347 12 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422347 1:2561033-2561055 AGGGCCATGGGAGGGCCCCTGGG 0: 1
1: 0
2: 0
3: 32
4: 548
900422334_900422339 -7 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422339 1:2561014-2561036 GTGGGTGTCCCTGAATGTCAGGG 0: 1
1: 0
2: 2
3: 16
4: 278
900422334_900422341 0 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422341 1:2561021-2561043 TCCCTGAATGTCAGGGCCATGGG 0: 1
1: 0
2: 0
3: 24
4: 151
900422334_900422345 4 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422345 1:2561025-2561047 TGAATGTCAGGGCCATGGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 234
900422334_900422353 26 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422353 1:2561047-2561069 GCCCCTGGGCTTCAGGGGTTGGG 0: 1
1: 0
2: 1
3: 24
4: 424
900422334_900422351 21 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422351 1:2561042-2561064 GGAGGGCCCCTGGGCTTCAGGGG 0: 1
1: 0
2: 3
3: 36
4: 319
900422334_900422340 -1 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422340 1:2561020-2561042 GTCCCTGAATGTCAGGGCCATGG 0: 1
1: 0
2: 1
3: 29
4: 244
900422334_900422344 3 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422344 1:2561024-2561046 CTGAATGTCAGGGCCATGGGAGG 0: 1
1: 0
2: 1
3: 20
4: 213
900422334_900422352 25 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422352 1:2561046-2561068 GGCCCCTGGGCTTCAGGGGTTGG 0: 1
1: 0
2: 0
3: 44
4: 356
900422334_900422349 19 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422349 1:2561040-2561062 TGGGAGGGCCCCTGGGCTTCAGG 0: 1
1: 0
2: 2
3: 40
4: 393
900422334_900422346 11 Left 900422334 1:2560998-2561020 CCTGTCCCCTGGGGCTGTGGGTG 0: 1
1: 0
2: 6
3: 48
4: 453
Right 900422346 1:2561032-2561054 CAGGGCCATGGGAGGGCCCCTGG 0: 1
1: 0
2: 0
3: 82
4: 616

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900422334 Original CRISPR CACCCACAGCCCCAGGGGAC AGG (reversed) Intronic
900099521 1:955536-955558 CACACACAGCTCCAGGAAACAGG + Intronic
900141785 1:1141781-1141803 CAGCCCGAGCCCCAGGAGACAGG + Intergenic
900422334 1:2560998-2561020 CACCCACAGCCCCAGGGGACAGG - Intronic
900461932 1:2805788-2805810 ACCACCCAGCCCCAGGGGACGGG + Intergenic
900547336 1:3236239-3236261 CTCCCACAGCCCCTGGGGCTGGG + Intronic
900612836 1:3551634-3551656 TTGCCACAGCCACAGGGGACAGG + Intronic
900762704 1:4483567-4483589 CACCTCCAGCCCCCCGGGACTGG - Intergenic
900830466 1:4961713-4961735 GCCCCAAAGCCCCAAGGGACAGG + Intergenic
900980904 1:6045616-6045638 CACCCACAGCCAAGGGGGTCTGG - Intronic
901146201 1:7066244-7066266 CAGCTACAGCCCCAGGAGCCAGG - Intronic
901213381 1:7539247-7539269 CAGCCACAGCCTTGGGGGACAGG + Intronic
901220347 1:7580231-7580253 CCTCCACAGCCCCAGGGGGAGGG - Intronic
901804152 1:11727083-11727105 CCCACACAGCCCCAGGTGGCTGG + Intergenic
902534958 1:17114204-17114226 CACCCCCAGCCTCAAGGGACAGG - Intronic
902849050 1:19139039-19139061 CACCCTCTGCCCAAGGAGACAGG + Intronic
903032689 1:20475177-20475199 CACCCCCAACTCCAGGGGAGGGG + Intergenic
903335489 1:22621731-22621753 GCCCCACAGCCCCATGGGGCAGG + Intergenic
903655065 1:24943952-24943974 CTCCCACAACACCAGGGAACTGG - Intronic
903967351 1:27099114-27099136 ATCCACCAGCCCCAGGGGACAGG + Exonic
904097283 1:27990051-27990073 GACCAACAGCCCCAGGGTGCAGG + Intronic
905548173 1:38816559-38816581 CACCAACAGCCCAAGGGGGAAGG - Intergenic
906150764 1:43586229-43586251 CACCCACTGGCCGAGAGGACAGG + Intronic
906191206 1:43900540-43900562 CACCAGCAGCCCCAGGGGTGGGG + Intronic
906756369 1:48320057-48320079 CATCAACAGCCTCTGGGGACTGG - Intronic
906811711 1:48833890-48833912 CCACCACAGGCCCAGGGGACAGG + Intronic
907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG + Intronic
908356513 1:63328819-63328841 CACCCCCAGCTCCAGGGGCAGGG + Intergenic
908769413 1:67582789-67582811 CATCCAATGCCCCGGGGGACAGG + Intergenic
910757132 1:90706066-90706088 CCCCCAAAGCCTCTGGGGACTGG - Intergenic
911450490 1:98054405-98054427 CGCCCCCAGCGCCAGGGCACTGG - Intergenic
912520394 1:110240860-110240882 CAGCCACAGTACCAGGGAACAGG + Intronic
913160396 1:116139950-116139972 CACCCACAGACCAAGGAGAAAGG + Intergenic
913190034 1:116405743-116405765 CAACCACAGCCCCAGTGTACAGG - Intronic
914718286 1:150268931-150268953 CACCCCCAGACCCCGGGGAAGGG + Exonic
914847475 1:151290995-151291017 ATCCCCCAGCCCCAGGGCACTGG - Exonic
915142223 1:153774927-153774949 CAGCCGCAACCCCAGGGGATGGG - Intronic
915510484 1:156384444-156384466 CACCCAGTGCCACAGGGCACAGG - Intronic
916043865 1:160983329-160983351 CACCCACAACCCTGGGGTACCGG + Intergenic
916818970 1:168379600-168379622 CACCCACAGGCACTGGGGAAGGG + Intergenic
917725872 1:177826602-177826624 CAACCAGAGCCCCAGGGGGAAGG - Intergenic
917969953 1:180199967-180199989 CACCCCCACACCCAGAGGACAGG - Exonic
918045249 1:180937357-180937379 CACCAACAGGCCCAGGGGCCAGG - Intronic
918141509 1:181723995-181724017 CCCCCACAACCCCTGGGGAGGGG - Intronic
918410564 1:184254089-184254111 CAGCCACATCCTCAGGGGTCGGG - Intergenic
919804879 1:201375645-201375667 TACCCAAAGCCCCAGGGGAGCGG + Intronic
920689381 1:208134371-208134393 CACCCACAGCCCCGGGAGGTGGG + Intronic
920753214 1:208702559-208702581 CTCCCACAGCCCCAGAGAGCTGG + Intergenic
921389901 1:214606753-214606775 CACCCCCACCCCCAGGTCACTGG + Intronic
922329398 1:224560835-224560857 TTCCCACAGACCCAGGGGAATGG - Intronic
922776220 1:228215298-228215320 CTCCAGCAGACCCAGGGGACGGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924242902 1:242057311-242057333 CACCCCCACCCCCAGGCCACCGG - Intergenic
1062832932 10:617822-617844 CCCCCCCAGCCCCAGGTGTCTGG + Intronic
1063161118 10:3419857-3419879 CACCCACAGCCCAATTGGATAGG - Intergenic
1066491655 10:35900570-35900592 CACCCTAAGTCCCTGGGGACTGG - Intergenic
1067085099 10:43234040-43234062 CACCCTCACCCCCAGAGGTCTGG + Intronic
1068887871 10:62116050-62116072 CACCCACTGTGTCAGGGGACAGG - Intergenic
1073122675 10:101131977-101131999 CACCCCCAGCCCCTGGCCACCGG + Exonic
1073143220 10:101262392-101262414 CTCCCGCAGCCTCTGGGGACTGG + Intergenic
1073146744 10:101286138-101286160 CACCCCCACCCCCAGCGGGCGGG - Intergenic
1073265660 10:102226956-102226978 CACACACAGCCACAAAGGACGGG - Intronic
1075432777 10:122402874-122402896 CAACCCCAGCCCCAGAGCACTGG + Intronic
1075874243 10:125793373-125793395 CTCCTACAGGCCCAGGGGAGAGG + Intronic
1076323927 10:129606029-129606051 CACCCAAAACTCTAGGGGACTGG + Intronic
1076785272 10:132746522-132746544 CGTCCACAGGCCCAGGGCACAGG - Intronic
1076864852 10:133161493-133161515 CACCTGCTGCCCCAGGGGAGTGG + Intronic
1077358335 11:2128751-2128773 CACCAACAGCCTTAGAGGACTGG - Intergenic
1077486803 11:2842484-2842506 CACACAAAGGCCCAGGGGCCTGG + Intronic
1077530528 11:3092745-3092767 CACCGACTCCTCCAGGGGACAGG + Intronic
1077538782 11:3136751-3136773 CACCCACAGCCCAGAGTGACAGG + Intronic
1077679515 11:4225617-4225639 GTCCCAAAGCCCCAAGGGACTGG + Intergenic
1077681972 11:4250290-4250312 GTCCCAAAGCCCCAAGGGACTGG - Intergenic
1077688929 11:4322197-4322219 GTCCCAAAGCCCCAAGGGACTGG + Intergenic
1078007932 11:7546569-7546591 CACCCACAGCATCAGGGGCCTGG - Intronic
1078093755 11:8283913-8283935 CCCCCACAGCCCCCGGGGCCCGG + Intergenic
1078402783 11:11043011-11043033 CACCCTCATCCAAAGGGGACTGG - Intergenic
1079102515 11:17550764-17550786 CAGCCCCAGCCCCAGGAGTCAGG - Intronic
1079803196 11:24896513-24896535 CAGCCACTGCCCCAGGGGGCAGG + Intronic
1079911476 11:26315988-26316010 CACCCTCAACCCCAGTGGAGAGG - Intronic
1080116878 11:28631325-28631347 CACCCACACCCAAAGGGGAGGGG + Intergenic
1081670234 11:44938546-44938568 CTCCCAGAGCCTCAGGGGCCTGG - Intronic
1083591017 11:63894935-63894957 CACCCACAGGACCTGGGCACTGG + Intronic
1084170095 11:67396851-67396873 CCCCCACCTTCCCAGGGGACAGG - Intronic
1084709472 11:70835152-70835174 GAGCCACAGCCCCAGTGCACAGG + Intronic
1085273146 11:75282113-75282135 GACCAAGGGCCCCAGGGGACAGG + Intronic
1085457399 11:76672759-76672781 CAACCACAGCCTCTGGGGGCGGG - Intergenic
1085507408 11:77068183-77068205 CACCCCCAGACCCTGGGGACAGG - Intronic
1087950909 11:104219426-104219448 CAGCCACAGCCAAAGGGGAATGG - Intergenic
1089680748 11:120117646-120117668 TGCCCCCAACCCCAGGGGACAGG + Intronic
1090187366 11:124747108-124747130 CGGCCACAGCCCCAGGAGCCCGG - Exonic
1090272463 11:125397783-125397805 CCCCCACCACCCCAGGGGAGGGG - Intronic
1090423218 11:126589845-126589867 CAGCCCCAGCCCCAGGAGGCAGG - Intronic
1091798365 12:3309843-3309865 CACCCACAGACCCAGGCAAGCGG - Intergenic
1092153418 12:6266866-6266888 CCTCAACAGCCCCAGGGAACAGG + Intergenic
1092282925 12:7110767-7110789 CACCGGCAGCCCCAGGTGACTGG + Intergenic
1092563654 12:9642355-9642377 CACCCACAATCCCACGGGAGTGG + Intergenic
1094589750 12:31809193-31809215 TACCTACAACCCCAGGGGACTGG + Intergenic
1095570077 12:43674938-43674960 GACCCAGAGCCTCAGGGGATGGG - Intergenic
1096199747 12:49673136-49673158 CACACTCAGCCCATGGGGACAGG + Intronic
1101409994 12:104459313-104459335 ACCCCAGAGCGCCAGGGGACTGG + Intronic
1101897773 12:108768981-108769003 CCTCCGCAGCCCCAGGGGGCAGG - Intergenic
1102298985 12:111757700-111757722 GACCCACATGCCCAGGGGTCTGG + Intronic
1103177685 12:118878825-118878847 CACCCACCTCCTCAGGGCACGGG - Intergenic
1103230591 12:119327223-119327245 AAACCACAGCCCCAGGCGAGAGG - Intergenic
1103699872 12:122843556-122843578 CACCCAGGGGCCCAGGGGGCAGG - Intronic
1103987622 12:124778269-124778291 GACCCACAGCCCCTGTGGTCAGG + Exonic
1104655764 12:130572840-130572862 CACCCACCAACTCAGGGGACAGG + Intronic
1104752464 12:131248388-131248410 CACCACAAGCCCCAGGGCACAGG + Intergenic
1104832468 12:131763072-131763094 CAACAACTGCCTCAGGGGACAGG - Intronic
1104875273 12:132029555-132029577 CACCCACATCCCCATGTGACTGG + Intronic
1105435291 13:20372146-20372168 ATCCCACAGCCTCTGGGGACAGG - Intergenic
1106483130 13:30151460-30151482 CACCCTCAGCACCATGGGACAGG + Intergenic
1108447267 13:50522041-50522063 CAGTAACAGCCCCAGGGGACTGG + Intronic
1110128420 13:71977437-71977459 CACCCTCAGGCCTAGGGGATGGG - Intergenic
1112223545 13:97515011-97515033 CACTCACATCCCCAGTGGAGAGG + Intergenic
1112705307 13:102061301-102061323 CTCCCAAAGCCCCAGTGGGCAGG - Intronic
1115203317 14:30875369-30875391 CACCCACAGCCCCAGACCCCGGG + Intronic
1118221077 14:63854520-63854542 TTCCCACCGCCCCAGGGGGCTGG - Intronic
1118615460 14:67572020-67572042 CACCCCCAGCCCCAGAGACCGGG + Intronic
1118642575 14:67806389-67806411 CTCCCACAGTCCCATGGGAAAGG - Intronic
1119432240 14:74575930-74575952 AACCCACAGCCCCAGGGAAGGGG + Intronic
1121473617 14:94174803-94174825 GACCCCCATCCCCAAGGGACGGG + Intronic
1121515873 14:94549512-94549534 CACCCCAAGCCCCAGGGCACGGG + Intergenic
1121541227 14:94728215-94728237 CAGCCAAAGCCCCAGGGAGCTGG + Intergenic
1121561844 14:94881789-94881811 CTCCCACAGCCCCATGAGAGGGG + Intergenic
1121832102 14:97061424-97061446 CAACCACAGCCACAGGGAACTGG + Intergenic
1122129256 14:99595686-99595708 CACCCACAGGGCAAGGGAACCGG + Intronic
1122789638 14:104178839-104178861 CAGCCACACCCCCAGAGGCCTGG - Intronic
1122883523 14:104700515-104700537 CAACCACAGACCCTGGGAACTGG - Intronic
1122953381 14:105058695-105058717 CACCCACAGCATGAGGGGCCCGG + Intronic
1123415678 15:20093314-20093336 CACCCACAGGCCCAGGCACCTGG + Intergenic
1123525017 15:21100428-21100450 CACCCACAGGCCCAGGCACCTGG + Intergenic
1124563123 15:30793395-30793417 GACTCACATCCCCAGGTGACTGG - Intergenic
1125604623 15:40932872-40932894 CACCCACAGCCTCAGGTGGCCGG - Intronic
1128374819 15:67066841-67066863 CACCCACAGCCCCAGCTGTACGG - Intronic
1128561720 15:68673016-68673038 AACCCACACCCCCAGGGAAAGGG + Intronic
1129107240 15:73318795-73318817 TCCCCACAGCCCCAGAGGCCAGG + Intergenic
1129474747 15:75777455-75777477 GACTCACAGCCCCAGGTGAGTGG - Intergenic
1129688973 15:77702433-77702455 CACCCTCCACCCCAGGGGCCTGG + Intronic
1129868266 15:78925148-78925170 CTCACACAGCCCCAAGGGCCAGG - Intronic
1129875616 15:78973605-78973627 CCCCCACCACCCCAGAGGACTGG - Intronic
1130043641 15:80427224-80427246 CAGCCCCAGCCCCAGTGGTCAGG - Intronic
1131098445 15:89670347-89670369 CACCTAAAGGCCCAGGGAACTGG + Intronic
1131585179 15:93684909-93684931 CACACTCAGCCCCAGGGGTGAGG - Intergenic
1132505783 16:307978-308000 CAACCACAGCCCCACCTGACAGG + Intronic
1132541878 16:513969-513991 CAACCTCAGCCCCAGCGGAAAGG - Intronic
1132554142 16:565253-565275 CACAGACAGCCTCAGGGGTCTGG - Exonic
1132763579 16:1523439-1523461 TTCCCACAGCCTCTGGGGACAGG + Intronic
1132854316 16:2038055-2038077 CTCCCCCAGCCTCAGTGGACTGG + Exonic
1132870008 16:2111770-2111792 CACCCACAGCCACGGAGGGCAGG + Exonic
1132882655 16:2169370-2169392 CAGGCAGAGGCCCAGGGGACGGG - Intronic
1132989122 16:2784125-2784147 GACCCACAGCCGCAAGGCACTGG - Exonic
1133168458 16:3965132-3965154 CACCCACAGCCCACGGGGCGCGG + Exonic
1133229912 16:4361519-4361541 TGCCCGCAGCCCCTGGGGACTGG - Intronic
1134717415 16:16363831-16363853 CACCCACAGCCTCGGAGGGCAGG - Intergenic
1134749007 16:16610989-16611011 CACACACAGCCACAGGAGAGTGG + Intergenic
1134827525 16:17296509-17296531 CAGCCAAGGCCCCAGGGGACAGG + Intronic
1134829467 16:17311575-17311597 CACCCACAGTCCCATGGATCTGG - Intronic
1134829775 16:17313565-17313587 CACCCACAGTCCCACGGATCTGG - Intronic
1134957337 16:18388328-18388350 CACCCACAGCCTCGGAGGGCAGG + Intergenic
1134996458 16:18742647-18742669 CACACACAGCCACAGGAGAGTGG - Intergenic
1136579562 16:31143245-31143267 CCCCCACACCCCCTGGGGAGGGG + Intronic
1137576328 16:49602623-49602645 CAGCCGCAGGCCCAGGGCACAGG + Intronic
1137988811 16:53131535-53131557 GGCCCACAGCCCCCGGGGTCGGG + Intronic
1139344447 16:66293516-66293538 CACCCCCACCCCCAGTGGATTGG + Intergenic
1139366602 16:66437530-66437552 CACCCACAGCCCCTGCAGGCTGG - Intronic
1140032298 16:71348474-71348496 CACCCACAGCAGCCGGGGAATGG + Intergenic
1140455013 16:75099921-75099943 CTCCCACAGCCCCAGGGGTGGGG + Intronic
1140634054 16:76889737-76889759 CAAGCACAGCCCTAGGGGCCTGG + Intergenic
1141089934 16:81123317-81123339 CACCCCCAACCCCAGCAGACAGG + Intergenic
1142005591 16:87688194-87688216 CACCCACACCCCCGTGTGACAGG + Intronic
1142068136 16:88074403-88074425 AACCCACTGCTCCAGGGAACAGG - Intronic
1142144036 16:88485255-88485277 TCCCCCCAGCACCAGGGGACAGG - Intronic
1142161217 16:88558637-88558659 GACTCACACCCCCAGGGAACGGG - Intergenic
1142161236 16:88558701-88558723 GACTCACACCCCCAGGGAACGGG - Intergenic
1142177010 16:88650099-88650121 CGCTCAGAGCCCCAGGGGAGTGG + Intronic
1142233628 16:88911224-88911246 CACCCACAGGCCTTGGGGTCAGG - Intronic
1143102549 17:4512406-4512428 CACCCACAGCCCCAGCAGACTGG - Intronic
1143388425 17:6545828-6545850 AACCCACAGCCCAATGGGGCAGG - Intronic
1143500638 17:7336674-7336696 CACCTGCATCCCCAGGGGCCCGG + Exonic
1143641998 17:8204490-8204512 CTCCCACAGCCCAGGGGCACTGG - Intergenic
1143884150 17:10053539-10053561 CACCACCAGCCCCATGGGAAGGG + Intronic
1144765723 17:17731406-17731428 CACCCACACCCCCAGGCCTCTGG - Intronic
1144945635 17:18968218-18968240 AACACACAGCCTCAGGGGCCAGG - Intronic
1144962344 17:19051938-19051960 CACCCCCAGCTCCAGGGCCCTGG + Intergenic
1144972817 17:19122582-19122604 CACCCCCAGCTCCAGGGCCCTGG - Intergenic
1146500840 17:33363229-33363251 CACCCACAGAACCAGGGGCAGGG + Intronic
1146935403 17:36809807-36809829 CCCCCCCAGCCCCAGAGCACAGG + Intergenic
1147041697 17:37724230-37724252 CACCCCCCACCCCAGGGAACTGG + Intronic
1147323271 17:39658558-39658580 TACCCACAGCCCCAAGAGAGGGG + Intronic
1147325118 17:39666339-39666361 GACCCTCAGCCCCAGGAGAAGGG + Exonic
1147417886 17:40306899-40306921 CAACCCCAGCCCCAAGGCACTGG + Intergenic
1147584156 17:41643432-41643454 GATCCACAGCCCCATGGGCCTGG + Intergenic
1148124494 17:45229851-45229873 CCACCACAGACCCAGGGCACTGG + Intronic
1148474293 17:47916836-47916858 CAGCCACAGCCACAGGGGGCTGG - Exonic
1149401165 17:56297255-56297277 CACACACAGCCTCAGAGGTCTGG - Intronic
1149443940 17:56699272-56699294 CACACACAGCCCCAAGGGACCGG + Intergenic
1149549786 17:57531862-57531884 CACCCACAGCAACAGGGATCTGG - Intronic
1150281538 17:63932039-63932061 CACCCACAGACCCAGGCCCCAGG + Intronic
1151538045 17:74749580-74749602 CACCCACAGACCCGAGGGAAGGG - Intronic
1151761232 17:76104278-76104300 CAACTGCAGCTCCAGGGGACGGG + Intronic
1152068019 17:78122027-78122049 CACCCACATCCACAGGGAACAGG - Intronic
1152130368 17:78472610-78472632 CACACACAGCCCCCGGGGCCAGG - Intronic
1152360038 17:79828426-79828448 CACCCACAAACCCAGGGCCCAGG - Intergenic
1152438231 17:80288996-80289018 CACCCACAGCCCGAGTGGCCGGG + Intronic
1152642874 17:81456504-81456526 CACCCACAGCCCAAGGGCCACGG + Exonic
1153294649 18:3534146-3534168 CAACCCCAGCCCCAGGGGACGGG + Intronic
1153544196 18:6189104-6189126 CACCTGCAGCCACAGGGTACTGG - Intronic
1153688355 18:7567776-7567798 CACCCACCGCCGCCGGGGAGCGG + Exonic
1154501929 18:15001524-15001546 CACCCCCATCCCCACGGGAGGGG - Intergenic
1156375556 18:36512103-36512125 CCCCCACGGTCCCAAGGGACTGG - Intronic
1157336108 18:46738723-46738745 CAGGCACAGCCCCAGGAGATTGG - Intronic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1160059150 18:75514034-75514056 CATCAACAGCCCCAGGAGCCCGG + Intergenic
1160285603 18:77539976-77539998 CACTCACAGCCACAGGAGGCTGG + Intergenic
1160660345 19:295251-295273 GAGCCACAGGACCAGGGGACGGG + Intergenic
1160846312 19:1167704-1167726 CACCCACGGCTCCAGGGGGTGGG + Intronic
1160848993 19:1180678-1180700 CACCCACTTCCCCAGCGGACGGG + Intronic
1160946121 19:1644838-1644860 CACCCAGAGGCCCAGGAGAATGG + Intronic
1161006596 19:1940393-1940415 CGCGCAGAGCCCCAGGGGAGCGG + Intergenic
1161013495 19:1971243-1971265 CACCCAGGGCCCCAGGAGGCCGG + Intronic
1161075315 19:2282409-2282431 CCCCCACAGCCTCAGAGGCCAGG + Intronic
1161160766 19:2760853-2760875 CTCCCACAGCCTCAGGGTACAGG - Intronic
1161179049 19:2867273-2867295 CAATCACAGCCCCAGGGGCGGGG + Intergenic
1161566656 19:5006278-5006300 CCCCCACAAGCCCAGGGGATGGG - Intronic
1162932066 19:13962357-13962379 CTCCCACCACCCCAGGGGGCAGG - Exonic
1163033969 19:14561166-14561188 CACCCAGAGCCCAGGGAGACCGG - Intronic
1163450325 19:17373331-17373353 CGCCCAGAGCCCCAGGGGTAGGG - Intronic
1163602011 19:18255006-18255028 GACCCACAGCCCCAGGGCTTGGG + Intronic
1164159696 19:22618173-22618195 CCCCCACATCCTGAGGGGACCGG + Intergenic
1164435672 19:28227026-28227048 CACAGCCAGCCCCAGGGGCCAGG + Intergenic
1164677263 19:30109827-30109849 CAGCCAGAGGCCGAGGGGACTGG - Intergenic
1165068449 19:33241859-33241881 CCCCCACCGCCCCCGGGGAGGGG + Intergenic
1165229473 19:34377901-34377923 CACACACAGGGCCAGGGGCCGGG - Intronic
1165700515 19:37933646-37933668 CACCCACAGCCACAGGTTCCTGG - Intronic
1166368801 19:42290487-42290509 GACCCCCAGCCCCAGGGGGTGGG - Exonic
1166559246 19:43720858-43720880 CAAAGACAGCCCCAGGGGCCTGG + Intergenic
1167529323 19:50005130-50005152 AGCCAACAGCCCCAGGAGACAGG + Intronic
1167560885 19:50226054-50226076 CTCCCTCAGACCCAGGGGTCTGG - Intronic
1167560997 19:50226351-50226373 CTCCCTCAGACCCAGGGGTCTGG - Intronic
1167636565 19:50659197-50659219 CACCCGGAGCCCCGGAGGACAGG + Exonic
1167685322 19:50952497-50952519 CACACAGTTCCCCAGGGGACAGG + Intronic
1168112999 19:54205239-54205261 TGCCCACAGCCCCAGGGCCCTGG - Intronic
1168325924 19:55538176-55538198 CACCCTCAGGCCCAGGAGTCCGG - Intergenic
1168388490 19:55986639-55986661 AACCACCAGCCCCAGGGAACAGG - Intronic
925105697 2:1289248-1289270 GACCCACATCCCCAGGTGACTGG + Intronic
925209416 2:2033793-2033815 CCCCAACGGCCCCTGGGGACAGG + Intronic
925306636 2:2851468-2851490 CACGCACAGCCTCTGGAGACAGG + Intergenic
925310499 2:2878294-2878316 CCCCCAAAGCCCCAGAGGATGGG + Intergenic
925876493 2:8315708-8315730 CACCCAGATCGCCAGGGCACAGG - Intergenic
925907592 2:8548470-8548492 TTCCCACAGCCCCAGGAGGCTGG + Intergenic
927138410 2:20113793-20113815 CACAGACAGCCCCAGGGCTCAGG + Intergenic
927692726 2:25219645-25219667 CACCCACCACCCCAGGGGGCTGG - Intergenic
927713886 2:25341080-25341102 CACCCCCAGCCACAGGTGGCCGG + Intronic
927873589 2:26639940-26639962 CCCCCACAGCCCCACGAGAAGGG + Intronic
928149090 2:28810524-28810546 CAGCCCCAGCCCCGGGGGCCTGG + Intronic
928210723 2:29321704-29321726 CACCCACACCCTCATTGGACGGG + Intronic
929431448 2:41890793-41890815 CACCCACAGCCTCCAGGGAGGGG + Intergenic
929604945 2:43227514-43227536 CACCCCCAGCCCCAGAGGGCTGG - Intergenic
929998269 2:46843201-46843223 CACACACCTCCCCAGGTGACTGG - Intronic
931069309 2:58626605-58626627 CACAGGCAGGCCCAGGGGACAGG - Intergenic
931230587 2:60371476-60371498 GACCCACAGCCACAGGACACGGG + Intergenic
932292410 2:70593751-70593773 GTCCCACAGCCCCAGGGCACAGG + Intergenic
932358346 2:71085414-71085436 CTTCCCCAGTCCCAGGGGACAGG - Intergenic
932370591 2:71184298-71184320 CTTCCCCAGTCCCAGGGGACAGG - Exonic
932389985 2:71379380-71379402 GACTCACAGCCCCAGTGGGCTGG - Intronic
933984225 2:87577224-87577246 CTCCCGCACCCCCAGGGGCCGGG - Intergenic
934897264 2:98129679-98129701 CACACACAGACCCAGGGTGCAGG - Intronic
935444899 2:103146004-103146026 CAAGCATAGCCACAGGGGACAGG - Intergenic
936309629 2:111373572-111373594 CTCCCGCACCCCCAGGGGCCGGG + Intergenic
936659199 2:114523397-114523419 CACCCACAGCAGCAGGGGTCTGG + Intronic
937205818 2:120236555-120236577 CACCCACAGTGCCAGGGCTCGGG - Intergenic
937363085 2:121242549-121242571 CACCCAGGGCCCCAGGGCGCAGG + Intronic
937986708 2:127641303-127641325 CAGCCTCAGCCCCAGGAGTCAGG + Intronic
938086915 2:128407769-128407791 AGCCCACAGCCTCAGAGGACAGG - Intergenic
938501109 2:131831693-131831715 CACCCCCATCCCCACGGGAGGGG - Intergenic
940863973 2:158798452-158798474 CTCCTCCTGCCCCAGGGGACAGG + Intronic
943348794 2:186772773-186772795 AACCCCCATCCCCAGGGGAATGG + Intergenic
946149843 2:217756804-217756826 CACCCCCAGGCCCTGGGGCCAGG + Intergenic
946307861 2:218866166-218866188 CACCCACAGCCCCAGGGCTCAGG + Intronic
946370588 2:219279318-219279340 CCCCCACCCCCCCAGGGGACAGG + Exonic
948333720 2:237191956-237191978 CTCCCACCGCCCCCGGGGATGGG + Intergenic
949017646 2:241722394-241722416 CACCCACAGCACCGGGGTTCTGG - Intronic
1168840754 20:908581-908603 CACCCACTGCTCCAGGGGCAAGG + Intronic
1169007020 20:2216082-2216104 CTTTCAGAGCCCCAGGGGACTGG + Intergenic
1169897749 20:10522535-10522557 TACCCGCAGGCCCAGGAGACCGG - Intronic
1171100338 20:22377136-22377158 AACCAACTGACCCAGGGGACTGG - Intergenic
1171381203 20:24735505-24735527 CATCCAGTGCCCCAGGGGATAGG + Intergenic
1172329996 20:34068864-34068886 CTCCCTCAGCCCAAGGAGACAGG - Intronic
1172786781 20:37473771-37473793 CACCCTCAGCACCTGGCGACTGG - Intergenic
1173952756 20:47006258-47006280 CACCCGCAGGACCAGGGGTCAGG + Intronic
1174038679 20:47683969-47683991 CACCCCCAGCCCCAGACAACTGG - Intronic
1174114306 20:48216349-48216371 CACCCACAGCCCCAAAGCCCAGG - Intergenic
1175186486 20:57182416-57182438 CAGCCACAGCCCCAGTGCCCGGG + Intronic
1175232242 20:57481346-57481368 CACCTCCAGACCCAGGGGAGGGG + Intergenic
1175686276 20:61031010-61031032 CCCCCACAGCCCCTGTGGTCAGG + Intergenic
1175915314 20:62423306-62423328 GACCCACAGCCCCAGGAGCTGGG - Intronic
1176028769 20:63000153-63000175 CACCCGGGGCCCCTGGGGACAGG - Intergenic
1176114260 20:63424279-63424301 CCCCCACAGTCCCATGGGTCAGG + Intronic
1176295474 21:5069850-5069872 CAGCCCCAGCCCCTGGGGTCTGG + Intergenic
1176299033 21:5089988-5090010 CACACTCATCACCAGGGGACGGG + Intergenic
1178267907 21:31161375-31161397 CACCCACAGTCACAGGAGAGAGG + Intronic
1178314799 21:31558980-31559002 CGCCCGCAGCCCCAGGGGCACGG - Intronic
1179857992 21:44171960-44171982 CACACTCATCACCAGGGGACGGG - Intergenic
1179861576 21:44192274-44192296 CAGCCCCAGCCCCTGGGGTCTGG - Intergenic
1180141126 21:45893825-45893847 CATCCAAGGCCCCATGGGACTGG - Intronic
1180150642 21:45945493-45945515 CTCCCACAGCCCCAGGGAGGGGG - Intergenic
1180229270 21:46416720-46416742 CTGCCACAGACCCAGGGGCCGGG + Exonic
1180732291 22:17991173-17991195 CACCAACAGGCCCAGATGACAGG + Intronic
1180972387 22:19822329-19822351 CCCCCACAGGCCCAGTGGTCTGG - Intronic
1181121042 22:20668897-20668919 CACCCCCACCCCCAGGTCACTGG + Intergenic
1181334008 22:22115923-22115945 CACCCTCACCCCCAGGTCACTGG + Intergenic
1181516980 22:23420175-23420197 CACCAACAGGCCCAGATGACAGG + Intergenic
1181542426 22:23580461-23580483 CACCCAGGGCCCCAGGGGCAAGG - Intergenic
1182102855 22:27670110-27670132 AACCCACAGCCTCTGGGGCCAGG - Intergenic
1182121611 22:27790854-27790876 CACCCACAGCCCAGGAGGCCCGG + Intronic
1182394950 22:30028527-30028549 CACCCACAGACCCATGTGATGGG - Intronic
1182431035 22:30299046-30299068 CCCCCATAGGCCCAGGGCACAGG + Intronic
1182544408 22:31066165-31066187 CACCCACAGGCCCAGGCACCTGG - Intronic
1183418748 22:37697778-37697800 CACACAGAGCCCCAGGGGGAGGG - Intronic
1184090631 22:42291288-42291310 CAGCCTGAGCCCCAGGGGAGGGG + Intronic
1184532979 22:45068539-45068561 CACCCACAGCTGGAGGGCACTGG + Intergenic
1184614974 22:45631804-45631826 CACTAAGAACCCCAGGGGACTGG + Intergenic
1184702896 22:46188740-46188762 GATCCACAGCCCCAGTGCACTGG - Intronic
1184856453 22:47149126-47149148 TGACCCCAGCCCCAGGGGACTGG - Intronic
1185107939 22:48884965-48884987 GACCCACTGGCGCAGGGGACCGG - Intergenic
1185135686 22:49070788-49070810 GACCCACAGCCCCAGGGAAGTGG - Intergenic
949872816 3:8603575-8603597 CACACACTGTCCTAGGGGACTGG + Intergenic
950177191 3:10883032-10883054 GCCCCACAGCCCAAGGGGGCGGG + Intronic
953033566 3:39192980-39193002 CACCCACCGTGCCAGGAGACTGG + Intergenic
954136092 3:48582852-48582874 AACCCTCAGCCCCAGGGACCTGG - Intronic
954176264 3:48847946-48847968 CCCCGACAGCCCGAGGGGGCGGG - Intergenic
954407844 3:50355397-50355419 CTCCCACACCCCCAGGGAAGGGG - Exonic
954747187 3:52793988-52794010 CACCCAGAGCTCCTGGGGGCTGG - Intergenic
954810567 3:53244743-53244765 CACACACAGCACCACGGGATGGG - Intronic
957794059 3:84980176-84980198 CACCGACAGCCCCAGATGCCTGG + Intronic
958044833 3:88271015-88271037 TACCCACAGTCCCAGGGGCTAGG + Intergenic
960548782 3:118949804-118949826 AACACACAGCCCCAGGAGAAAGG + Intronic
961270365 3:125683379-125683401 CCCCCACAGGCCCAGGAGTCAGG - Intergenic
962283293 3:134067699-134067721 GACCCACAGCGCCAGGAGTCAGG + Intronic
963103378 3:141625478-141625500 CAGCCAGAGCCCAGGGGGACAGG + Intergenic
966313986 3:178625149-178625171 CACACACAGTCCCAGGAGCCAGG + Intronic
967134076 3:186497990-186498012 CTCCCACAGCCCCAGGCTTCAGG + Intergenic
967965659 3:194958161-194958183 CACACACAGCCCCAGGACGCTGG + Intergenic
967981836 3:195070398-195070420 CCCACACAACCCCAGGGGATGGG + Intronic
968284980 3:197503206-197503228 CGCCCTCAGCCCCACAGGACTGG + Intergenic
968307904 3:197661625-197661647 CAGCCACCGCCCCAGCGTACCGG - Intergenic
968451879 4:679761-679783 CACCCACTGCCCCACGTGCCTGG + Intronic
968472457 4:788308-788330 CACCTGCAGCCCTAGGGGAGGGG - Intronic
968581971 4:1399414-1399436 CACCCCCAGCCCCAGGCAGCTGG - Intergenic
968817886 4:2831210-2831232 CACTCAGAGCCACAGGGGAGTGG - Intronic
968887131 4:3341092-3341114 CAGCCACAGCCCCTGGGTGCTGG + Intronic
968903136 4:3440444-3440466 CTAGAACAGCCCCAGGGGACTGG - Intergenic
968973943 4:3811408-3811430 CAGCCAAAGCCCCAGGCCACGGG - Intergenic
969115860 4:4870417-4870439 CACACACACCCTCGGGGGACTGG - Intergenic
969363948 4:6683069-6683091 CACCCACAGCTCCAGGAAAGGGG + Intergenic
969704880 4:8786217-8786239 AACCCACACCCCAAGGCGACCGG - Intergenic
969859680 4:10025818-10025840 CTCCCACTGACCCAGGGGAAAGG + Intronic
972737058 4:41852912-41852934 CACCCCCATTCCCAGGGCACTGG + Intergenic
975519967 4:75290076-75290098 GAGCCACAGACCCAGGGTACAGG + Intergenic
976769322 4:88634321-88634343 CAGCCAAATCCCCAGGGGAAGGG + Intronic
981093325 4:140755804-140755826 GTCGCCCAGCCCCAGGGGACCGG + Intronic
982316906 4:154041259-154041281 GACCCACTGCCCCAGGTGAGAGG + Intergenic
985128926 4:186723248-186723270 CACCCAGAGACCCAGGGACCCGG + Intronic
985492328 5:187072-187094 CTCCCACGGCCCCAGGGTGCCGG + Exonic
985522832 5:386781-386803 GACCCAGAGCCTCAGGGCACAGG - Intronic
985522845 5:386841-386863 GACCCAGAGCCTCAGGGCACAGG - Intronic
985522858 5:386901-386923 GACCCAGAGCCTCAGGGCACAGG - Intronic
985559387 5:574980-575002 CACCCACAGCAACAGAGGTCAGG + Intergenic
985813162 5:2105430-2105452 AACCCACAGACCCAGGGCAGGGG - Intergenic
987006623 5:13717049-13717071 CACCCACACCCCCTGAGAACAGG + Intronic
989341931 5:40385854-40385876 CACCCATACCCCCTGGGTACAGG + Intergenic
991391043 5:66144122-66144144 CAGCAACAGCCCCAGGGACCCGG + Intronic
992195021 5:74330553-74330575 CACCAACAGCCCCAAGGGAAGGG + Intergenic
993280642 5:85920880-85920902 AACCCACAGCCCCACCAGACTGG + Intergenic
993854193 5:93052501-93052523 CATCCACCACCCCAGTGGACGGG - Intergenic
996567236 5:124892667-124892689 CACCCACCTCCCCACGGGGCAGG + Intergenic
997889568 5:137663346-137663368 CAGCCCCAGCCCCAGGGCACTGG + Intronic
998042365 5:138959775-138959797 CACCCACAGTCCAATGGGCCTGG + Intronic
998231499 5:140363953-140363975 TACCCATAGTCCCAGGGGAAGGG - Intronic
998372318 5:141669921-141669943 CACCCACTGACCCAGGTGACAGG - Exonic
999216398 5:149939168-149939190 CACCCACAGGCCCAAGTCACTGG + Intronic
999312645 5:150561754-150561776 CAGCCTCAGGCCCAGGGGGCAGG - Intergenic
1000012335 5:157244499-157244521 CACCCACAGGTCCAGGGTAAAGG + Intronic
1001149942 5:169218504-169218526 CAACCACATCTCCAGGTGACTGG + Intronic
1001279370 5:170375504-170375526 CACTCAAAGCCACAGGGGCCAGG - Exonic
1001622808 5:173102727-173102749 CACCCACAGTCCTAGTTGACAGG - Intronic
1002580701 5:180208263-180208285 CTCCCACAGCCCCAGGAGGCAGG + Intronic
1003276757 6:4660540-4660562 CAACCCCAGCCCCAGCGGGCAGG + Intergenic
1003297398 6:4844041-4844063 AAGCCACATCCCCAGGGGAAGGG - Intronic
1004705619 6:18121744-18121766 CACCCCCTGGCCCTGGGGACTGG - Exonic
1005947203 6:30603179-30603201 CAGGGCCAGCCCCAGGGGACTGG - Intronic
1006293793 6:33160845-33160867 TACCCACAGGCCCAGAGGCCTGG + Intergenic
1006650829 6:35549916-35549938 CACCCAGAGCCCCTGGGCAAAGG + Intergenic
1006781674 6:36636592-36636614 CTCCCACAGCTCCAAGGAACAGG + Intergenic
1007482677 6:42160355-42160377 CAGGCTCAGCCCCAGGGCACAGG - Intronic
1009742053 6:67758607-67758629 CCCCCACAGCTCCAGGTAACAGG + Intergenic
1010067649 6:71703868-71703890 CACCCAGATCCTCAGGAGACAGG - Intergenic
1010542855 6:77113550-77113572 CACCCATAGCCCCACAGTACAGG - Intergenic
1011225271 6:85097806-85097828 AACCCACATCCCTAGGGGAAGGG + Intergenic
1011607759 6:89120604-89120626 CTCCCACAGCACCAGGATACAGG - Intergenic
1013188466 6:107782403-107782425 CACACTCAGCCCCCCGGGACCGG - Intronic
1013832030 6:114284536-114284558 CAACCACAACCCAAGGGGAATGG + Intronic
1014255505 6:119157082-119157104 GACCCTCAGCCCCAAGGGGCTGG - Intergenic
1015543811 6:134342355-134342377 CAGCTGCAGCCCCTGGGGACAGG - Intergenic
1016915140 6:149237738-149237760 CACCCACAGTGGGAGGGGACTGG - Intronic
1017820270 6:158044090-158044112 CACCCACGTCCCCTCGGGACAGG - Intronic
1018066973 6:160131306-160131328 CAGTCACTGCCCCAGGAGACAGG + Intronic
1018066984 6:160131344-160131366 CAGGCACTGCCCCAGGAGACAGG + Intronic
1018176904 6:161184960-161184982 CACCCACACACCCAGAGCACAGG + Intronic
1018795053 6:167179336-167179358 CAGCCACGGCCCCTGGAGACCGG - Intronic
1018821265 6:167375726-167375748 CAGCCACGGCCCCTGGAGACCGG + Intronic
1019103125 6:169648204-169648226 CACCCACAGCGGCATGAGACTGG - Intronic
1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG + Intergenic
1019297392 7:285341-285363 CAGCCACAGCCCCAGGGGCGGGG - Intergenic
1019324257 7:430233-430255 CACCCTCAGCCCCAGGCAAGAGG - Intergenic
1019583210 7:1779626-1779648 CCACCACAGCACCAGGCGACAGG - Intergenic
1019661988 7:2229697-2229719 CACTCACAGACCCTGGTGACAGG - Intronic
1020116552 7:5479606-5479628 TGCCCACGGCCCCAGGGGGCAGG - Intronic
1020899800 7:13990434-13990456 TCCCCACAGCCACAGTGGACTGG - Intronic
1023881961 7:44325739-44325761 CACCCGCACCCGCAGGGCACCGG + Intronic
1023969148 7:44978686-44978708 AAAGCACGGCCCCAGGGGACAGG - Intronic
1026193630 7:68152394-68152416 TACCAGCAGCCACAGGGGACAGG + Intergenic
1026554336 7:71392738-71392760 CTCCCAAATACCCAGGGGACCGG + Intronic
1028933674 7:96442271-96442293 CCCCCACAGCCCCAGCTGACTGG - Intergenic
1029457677 7:100679264-100679286 CACCCCCAGCCCCAGCTGCCTGG - Intergenic
1029495126 7:100892459-100892481 CACCCCCATCCACAGGGGCCAGG + Exonic
1029727394 7:102416119-102416141 CACACACAACCCCATGGGGCAGG - Intronic
1032400850 7:131623285-131623307 CAGCCACACCCCCACGGGCCCGG - Intergenic
1032512342 7:132481870-132481892 CACCCACAGGACCAGGGGTGAGG - Intronic
1033251933 7:139768021-139768043 CACCCACAGGCCCTGGGAAAGGG - Intronic
1033441618 7:141385304-141385326 TATACACAGCCCAAGGGGACTGG - Intronic
1034469551 7:151248125-151248147 CACCCCCACCCCCAGGGCAGGGG + Intronic
1034674483 7:152882755-152882777 CGGCCACAGCCCCAGAGGCCGGG - Intergenic
1034867189 7:154651833-154651855 CCCCCACAGCCCCAGGATGCTGG + Intronic
1035156687 7:156920198-156920220 CACCCACAGCCCAAGTGACCCGG + Intergenic
1035263704 7:157676986-157677008 CTCACACAGCACCAGGGGAGGGG - Intronic
1035448117 7:158956821-158956843 TGCCCACAGCCCCAGGGATCAGG - Intergenic
1035769733 8:2137504-2137526 CACACACAGACCCGTGGGACAGG - Intronic
1036075102 8:5489911-5489933 CACCCACAGGCCCAAGGGAGAGG - Intergenic
1036380889 8:8235860-8235882 CTCCCACAGCACCACGGGTCTGG + Intergenic
1036611737 8:10356111-10356133 CAGCCACAGCACCAGGGGTCTGG + Intronic
1036774206 8:11598931-11598953 CATCCACAAACCCAGGGGAGAGG + Intergenic
1037099969 8:15032742-15032764 CCCCCACAGCCCCAGACGTCAGG + Intronic
1037433061 8:18834476-18834498 CATCCACAGCCCCTGGCAACAGG + Intronic
1039058230 8:33553663-33553685 CACAAACAGCCCCAGTGGAAGGG + Intronic
1040802505 8:51358755-51358777 CCCCCACAACCCCAGGGGACAGG + Intronic
1040840800 8:51782140-51782162 CACCCACAGCCTCCGGGGGCTGG + Intronic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1047998643 8:130358766-130358788 CGCGCACAGCCCCTGGGGCCTGG + Intronic
1048234077 8:132673750-132673772 TACCCACACCCTCAGGGCACAGG + Intronic
1048283434 8:133122644-133122666 CTCCCACAGCCCTATGGAACAGG - Intronic
1049021059 8:139957950-139957972 CACCCACAGCCCCTGAGGAGAGG + Intronic
1049251038 8:141589082-141589104 CACGCCCAGCCCCAGAGGATGGG + Intergenic
1049372522 8:142274610-142274632 CTCCCAGAGCCCTAGGGCACGGG + Intronic
1049503109 8:142978628-142978650 CCCCCACAGGACCAGGGGCCAGG + Intergenic
1049557617 8:143291011-143291033 CTGCCACAGCCCCGGGGGCCTGG + Intronic
1049659014 8:143811456-143811478 CCCTCACAGCCCCTGGAGACCGG + Intronic
1050460867 9:5876237-5876259 CAGCAACAGCCCCTAGGGACTGG - Intergenic
1051546287 9:18279834-18279856 CACCCACAGACCCAGGCTCCAGG - Intergenic
1052840738 9:33289456-33289478 CACACACAGTCCCAGGAGCCAGG - Intergenic
1053286182 9:36850902-36850924 GACCCAAAGCCTCATGGGACTGG + Intronic
1053351599 9:37417055-37417077 CACCCACTGCCCCAGAGGCTGGG + Intergenic
1056395695 9:86179346-86179368 AACCCACAGCCCCAGGACACAGG - Intergenic
1056647231 9:88424290-88424312 TACCCACAGCCTCAGCAGACAGG - Intronic
1056964482 9:91154663-91154685 CAACCATAGCCCCCGGAGACAGG - Intergenic
1058013527 9:100004292-100004314 CACTCACAGACCCAGGGTTCAGG - Intronic
1058486648 9:105448301-105448323 CACCCACAGCCCACGGGCCCAGG - Intronic
1060520257 9:124290338-124290360 CATCCACAGGCCCTGGGGGCCGG - Intronic
1060872848 9:127056592-127056614 CACCCCCAGCCCCAGTGGAATGG + Intronic
1060877435 9:127093451-127093473 CCACCACAGCCCCACAGGACAGG - Intronic
1061008930 9:127943929-127943951 CATCCACATCCCCAGGGAAGAGG - Intronic
1061062578 9:128258040-128258062 CAGCCCCAGCCCCAGGGACCGGG - Exonic
1061133215 9:128719842-128719864 CACCCAGAGGCCCAGGAAACAGG - Intronic
1061219009 9:129238067-129238089 CACTCACAGCTCCAGGGAACAGG - Intergenic
1061318993 9:129815917-129815939 GACCCACAGCCACAGGGGCAGGG - Intronic
1061387284 9:130297879-130297901 CACCCACTTCCACTGGGGACAGG - Intronic
1061562566 9:131415421-131415443 CAGCCCCAGCCCCAGGGGAGCGG - Intronic
1061713761 9:132505709-132505731 CAGCCCCAGCCCCAGGAGCCAGG - Intronic
1061857133 9:133448558-133448580 GACCCAGAGCCCCAAGGGACAGG - Intronic
1061918979 9:133771908-133771930 CCACCCCAGCCACAGGGGACAGG - Intronic
1062056807 9:134473039-134473061 CACCCCCATCTCCAGGGGGCTGG + Intergenic
1062132700 9:134908562-134908584 CCCCCCAAGCCCCATGGGACAGG - Intronic
1062397393 9:136357960-136357982 CCCCCCCAGCCCCAGTGGTCCGG - Intronic
1062432894 9:136533819-136533841 CCCCCACAGCCCAAGCGGTCAGG - Intronic
1062498556 9:136842823-136842845 CACCCCCATCCCCACGGGAGGGG + Intronic
1062595595 9:137297700-137297722 CAGGCACAGCCCTAGGGGGCGGG - Intergenic
1062595605 9:137297742-137297764 CAGGCACAGCCCTAGGGGGCGGG - Intergenic
1062595615 9:137297784-137297806 CAGGCACAGCCCTAGGGGGCAGG - Intergenic
1062595624 9:137297826-137297848 CAGGCACAGCCCTAGGGGGCAGG - Intergenic
1062595633 9:137297868-137297890 CAGGCACAGCCCTAGGGGGCAGG - Intergenic
1062595663 9:137298034-137298056 CAGGCACAGCCCTAGGGGGCAGG - Intergenic
1062595679 9:137298116-137298138 CAGGCACAGCCCTAGGGGGCAGG - Intergenic
1062599341 9:137312945-137312967 CACCCACTGCCCCAGGCTGCAGG + Intronic
1062599720 9:137314411-137314433 CACACACCTCCCCAGGGGCCAGG - Intronic
1186990599 X:15063060-15063082 CACTCACAGCAGCTGGGGACTGG + Intergenic
1187438067 X:19290696-19290718 CGCCCTGAGCCCCAGGGCACTGG - Intergenic
1187484760 X:19693097-19693119 GCCCCACATCCCCATGGGACTGG + Intronic
1187836497 X:23437077-23437099 CCCCCACAGCCCCAGGGGCCTGG + Intergenic
1190584214 X:51921700-51921722 CACCAACAACCCCAGGAGATGGG - Intergenic
1191956926 X:66652057-66652079 CCCCCACAGCCCCAGGATCCAGG + Intergenic
1192382801 X:70635835-70635857 CCCACACAGCCCCAGGCTACAGG + Intronic
1192541060 X:71973545-71973567 CACCCCCAGCTCCAGGGCAGTGG - Intergenic
1195087204 X:101423756-101423778 CACCCCCAGCCTCTGGGGAAGGG + Intronic
1197262571 X:124333884-124333906 CACCCACTGTCCCCGGGGAGGGG - Intronic
1198518141 X:137428543-137428565 CACCCCCAGCCCGGGGGGAGGGG + Intergenic
1200085807 X:153604215-153604237 CACCCAGATCCCCCGGGAACTGG - Intergenic
1200231627 X:154446587-154446609 CGCCCGCAGCCCCTGGGGAGGGG + Intronic