ID: 900428371

View in Genome Browser
Species Human (GRCh38)
Location 1:2590759-2590781
Sequence CCCCGCGGGTGTCTGTGGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900428371 Original CRISPR CCCCGCGGGTGTCTGTGGAG GGG Exonic
900428371 1:2590759-2590781 CCCCGCGGGTGTCTGTGGAGGGG + Exonic
901526744 1:9827873-9827895 CTTGGCGGGTGTTTGTGGAGCGG + Intergenic
903224344 1:21886376-21886398 CCCCGGGGCTTGCTGTGGAGTGG + Intronic
903349921 1:22711209-22711231 CCCCGCGGGCGCCCGGGGAGCGG + Intronic
904345683 1:29867269-29867291 CCCCAAGGATGTCTGGGGAGGGG - Intergenic
904377429 1:30090547-30090569 CCCTGGGGGTGGCTGTGGAGGGG + Intergenic
917865500 1:179190579-179190601 CCCCCCACGTCTCTGTGGAGGGG - Intronic
1063428970 10:5972191-5972213 CCCTGAGGGTTTCTGTGCAGGGG - Intronic
1067099256 10:43322819-43322841 CCCCTTGAGTGTCTGTGCAGGGG + Intergenic
1067227270 10:44384388-44384410 CCCCGCGAGGGTGTGGGGAGAGG + Intronic
1067546546 10:47196340-47196362 CCATGCTGGTGTCTGTAGAGAGG - Intergenic
1068355808 10:55907151-55907173 CCCAGGGGGTTTCTGTGGTGGGG + Intergenic
1071515140 10:86292087-86292109 CCTGGAGGGTGTCTGTGGAGGGG - Intronic
1073432160 10:103493885-103493907 GCCCGCGGGTCTGCGTGGAGCGG - Intergenic
1074856645 10:117478989-117479011 CTCCCCAGGTGTCTGAGGAGGGG - Intergenic
1076327891 10:129642582-129642604 CCTCAGGGGTGTGTGTGGAGGGG + Intronic
1076998628 11:311250-311272 CCCCGCGGGGGTCTGGGCTGCGG - Intronic
1077000115 11:318509-318531 CCCCGCGGGGGTCTGGGCTGCGG + Intergenic
1077051503 11:568826-568848 GCCCGCGGGTGTGCGTGGGGCGG + Intergenic
1077328750 11:1974804-1974826 CCCAGCGGGGGCCTGTGGGGAGG + Intronic
1080800193 11:35603192-35603214 CAATGCGGGTGTGTGTGGAGGGG - Intergenic
1081793332 11:45804251-45804273 CCCCGGGGGTGCCGGCGGAGAGG - Intronic
1081872165 11:46388143-46388165 GCCCGCGTGCGTCTGTGGAGCGG - Intergenic
1083599763 11:63939377-63939399 CCCCGCGGGGGACGGTGGTGGGG - Intronic
1084010685 11:66346830-66346852 CCCAGCGAGGGGCTGTGGAGAGG - Exonic
1084957179 11:72697638-72697660 CCCCCTGGATGGCTGTGGAGGGG + Exonic
1085309954 11:75510360-75510382 CCCAGTGGGTGTTTGTGGACTGG - Intronic
1089194852 11:116688249-116688271 CCACGTGGCGGTCTGTGGAGGGG - Intergenic
1090977051 11:131687572-131687594 CCCCGGGGGTGGCTGCCGAGTGG + Intronic
1202811729 11_KI270721v1_random:29983-30005 CCCAGCGGGGGCCTGTGGGGAGG + Intergenic
1096478570 12:51923500-51923522 CCCCGCGGGGGTCTGAGCAGGGG - Intergenic
1096570446 12:52520125-52520147 CCTTGCGGGTGCTTGTGGAGTGG - Exonic
1104897302 12:132170714-132170736 CCCCCGGTGTGTGTGTGGAGAGG + Intergenic
1105782442 13:23716257-23716279 CCCCCGGGGTTCCTGTGGAGTGG + Intergenic
1105850311 13:24328396-24328418 CCGCGCGGGTGCGTGTGGTGAGG - Intergenic
1109370918 13:61417779-61417801 CCCAGCTGGTCTCTGTGGAAAGG + Intronic
1113614444 13:111670818-111670840 CCCCTGGGGTCTGTGTGGAGGGG + Intronic
1113619912 13:111755732-111755754 CCCCTGGGGTCTGTGTGGAGGGG + Intergenic
1113628369 13:111863290-111863312 CCTCGGGGCTGTCTGTGGTGCGG - Intergenic
1119225445 14:72941487-72941509 CCCCCCGGGTGTATGTGGATGGG + Intronic
1121020241 14:90575549-90575571 ACCCTCTGGTGCCTGTGGAGGGG - Intronic
1122181543 14:99958681-99958703 CCCCGCGGCTGGCTTTGAAGAGG + Intergenic
1122907029 14:104806308-104806330 CTCCAGGGGTGTCTGTGGAGTGG - Intergenic
1123004964 14:105316680-105316702 CCACTCTGGTGTCTGTGGGGAGG + Intronic
1129979029 15:79849386-79849408 CCCCAGGGGTGTGTGTGGGGTGG - Intronic
1130112835 15:80980151-80980173 GCCCACTGGTCTCTGTGGAGTGG - Intronic
1131249278 15:90820032-90820054 GCAGGCGGGTGTCTGTGGTGGGG - Intergenic
1132748709 16:1447554-1447576 GCCCGCAGGTGTTTGTGGAGCGG - Exonic
1132840116 16:1974755-1974777 CCCCGCAGGTGGCTGTGATGGGG + Exonic
1139637223 16:68264891-68264913 GACCGGGGGTGTGTGTGGAGAGG + Intronic
1140454384 16:75096345-75096367 TTCCGGGGGTGTATGTGGAGTGG + Intronic
1140664317 16:77213724-77213746 CCCTGTGGGTGTCTGGGGAAAGG + Intergenic
1142200440 16:88758552-88758574 GTCCGTGGGTGCCTGTGGAGTGG - Intronic
1142230880 16:88899757-88899779 GCCTGAGGTTGTCTGTGGAGCGG + Intronic
1142254180 16:89006108-89006130 CAACGCGGGTGGCTGAGGAGAGG + Intergenic
1142378902 16:89721024-89721046 CCCCACGGGTGTTAGTGGCGGGG + Intronic
1143200754 17:5111676-5111698 CTCCGCGGTTGTGTGTGGAGAGG - Intronic
1144628944 17:16860452-16860474 TCCCTCGGGGGACTGTGGAGTGG - Intergenic
1144652466 17:17015663-17015685 TCCCTCGGGGGACTGTGGAGTGG + Intergenic
1150467108 17:65403150-65403172 CCTCCCTGGGGTCTGTGGAGGGG - Intergenic
1152753588 17:82077753-82077775 CCCCACGGGTGGCTGTGCGGGGG - Intergenic
1152753775 17:82078545-82078567 CCCCACGGGTGGCTGTGCGGGGG + Exonic
1154209229 18:12365208-12365230 CCCAGCGGGTGTCTGTGGGGTGG - Intronic
1159359547 18:67382077-67382099 CCCCGTGTGTGTCTGAGCAGCGG + Intergenic
1160129125 18:76208788-76208810 AACCCCGGGTGTCTCTGGAGAGG + Intergenic
1160763796 19:798201-798223 GCCCGCGGGGGTCCCTGGAGAGG - Intronic
1161212428 19:3074339-3074361 CCCCTTGGGTGTCTATGGGGAGG - Intergenic
1161219204 19:3110338-3110360 GCCCGCGGGCGCCTGGGGAGGGG + Intronic
1161298607 19:3532198-3532220 CCCTGCTGATGGCTGTGGAGTGG - Intronic
1162109027 19:8390357-8390379 CCCGTCGGGTGTTTGTGGTGGGG + Exonic
1162502224 19:11060407-11060429 ACCCGTGGGTGTCTGGGGACTGG + Intronic
1163786061 19:19275512-19275534 CCCACTGGGTGTGTGTGGAGGGG + Intergenic
1165729476 19:38135492-38135514 ACCCGTGGGAGTGTGTGGAGAGG - Intronic
1165740731 19:38203771-38203793 CTCAGCAGGTGTCTGTAGAGTGG + Intronic
1166205494 19:41266077-41266099 ACCTGCGGTTGTCTGAGGAGAGG + Intronic
1167371519 19:49085466-49085488 CCGCGCGGGTGGCTGAGCAGCGG + Exonic
1168130032 19:54312122-54312144 CCCAGAGGGTGGCTTTGGAGAGG + Exonic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
936412838 2:112275705-112275727 CGCCGCCGGTGGCTGTGGCGTGG - Exonic
938081797 2:128374153-128374175 CCCTGCTGGAGTCTGTGCAGTGG - Intergenic
944541435 2:200757430-200757452 CCCAGTGGGTGTGAGTGGAGTGG - Intergenic
946429418 2:219616772-219616794 CGCAGAGGGTGTCTGGGGAGAGG + Intergenic
948207297 2:236168847-236168869 CCCCGGGGGTGGCTCCGGAGGGG - Intergenic
1170961548 20:21029803-21029825 CCCCTTGGGTGTGTGTGTAGTGG - Intergenic
1172208231 20:33179802-33179824 GCCCCCGGGTGCCTGTGGAGGGG - Intronic
1172359540 20:34302783-34302805 CCCGGAGGGTGTATGAGGAGAGG - Intronic
1172624040 20:36337311-36337333 CCCAGCGGCAGGCTGTGGAGGGG + Intronic
1180080296 21:45483584-45483606 CTCCGGGGGCGTCTGTGGTGGGG - Intronic
1180099281 21:45576889-45576911 GCCCGAGGCTGTCTGGGGAGAGG - Intergenic
1180154692 21:45972283-45972305 CCCTCTGGGTGTCTGAGGAGTGG + Intergenic
1181313155 22:21956327-21956349 CTCCTCGGGTGGCTGGGGAGGGG + Intergenic
1181346260 22:22222399-22222421 CTCCTCGGGTGGCTGGGGAGGGG + Intergenic
1183605147 22:38863700-38863722 CCCTGGGGGTGGCTGGGGAGAGG - Exonic
1184571917 22:45330656-45330678 CCCCGCAGGGGTCCGTGTAGAGG - Exonic
1184688116 22:46105512-46105534 CCCGGCAGGTGTCTGGGGAAGGG - Exonic
950466825 3:13160782-13160804 CCCAGGGGGTGTCTGTGCAGTGG - Intergenic
951955006 3:28243807-28243829 CCACGCACGTGTCTGTGTAGGGG - Intronic
954822922 3:53347303-53347325 CCGCGCGGGTTACTGTGGGGTGG - Intronic
954900637 3:54016284-54016306 CCCCGCTTGTGGCTGTGGGGAGG + Intergenic
961495835 3:127290371-127290393 CCACTCTAGTGTCTGTGGAGTGG + Intergenic
962326672 3:134440330-134440352 CCCAGCTGGTGTCTGTGGCTTGG - Intergenic
962696739 3:137955976-137955998 CCCAGAGGGTGTATCTGGAGGGG - Intergenic
969726188 4:8919900-8919922 CCCCAATGGTGTCTGTGCAGGGG - Intergenic
970394822 4:15655329-15655351 CGGCGAGGGTGTCTATGGAGAGG - Exonic
973246602 4:48016768-48016790 CGCCGCGGGTGCGTGTGGAGAGG + Exonic
986213220 5:5694015-5694037 CTCCACGGGTGCCTGTGGAATGG - Intergenic
988738715 5:34048529-34048551 CCCTGCAGGTTTCTGTGTAGGGG + Intronic
989462969 5:41722713-41722735 CCCAGCAGGTGTCTGTGCAGTGG + Intergenic
992528091 5:77630614-77630636 CCCAGCGGGTGTCGTTGGCGTGG + Exonic
1000463537 5:161548892-161548914 CCCGGCCGGTGTCTGCGGAGAGG + Intronic
1004045785 6:12021493-12021515 CCCAGGGCATGTCTGTGGAGGGG - Intronic
1007471854 6:42096019-42096041 CCCCGTGTGTGCATGTGGAGTGG - Intergenic
1010781057 6:79946967-79946989 CCCTGCGAGTGTCGGGGGAGGGG + Intronic
1015276475 6:131387750-131387772 CTCCTCACGTGTCTGTGGAGAGG + Intergenic
1015477557 6:133670595-133670617 CCTCCCGGGTGTCAGTTGAGAGG + Intergenic
1017898097 6:158698946-158698968 CTCTGCTGGTGCCTGTGGAGTGG - Intronic
1018709344 6:166486610-166486632 CCATGCTGGTGTCTGTGGAAAGG - Intronic
1019165977 6:170097812-170097834 TCCTGAGGGTGACTGTGGAGAGG - Intergenic
1019189123 6:170239959-170239981 CCACACGGGTGTCAGTGGGGTGG + Intergenic
1019607027 7:1915116-1915138 CCCAGCAGGTATGTGTGGAGAGG + Intronic
1020153227 7:5700086-5700108 CCCCGTGGGTGTCTGTGTCAGGG - Intronic
1035462835 7:159055711-159055733 CCCCCTGTGTTTCTGTGGAGTGG + Intronic
1036604265 8:10292542-10292564 CCCACCGGGTGGCTGTGAAGAGG - Intronic
1037752618 8:21692678-21692700 CCCCACGGATGGCGGTGGAGGGG - Exonic
1049209140 8:141377277-141377299 GCCTGTGGGTGTCTGGGGAGTGG + Intergenic
1050382428 9:5043127-5043149 CCCCGCAGGTGTATGTGCAGGGG + Intronic
1055574416 9:77647588-77647610 CCGCGCGGGTGCCAGTGGAGAGG + Intronic
1057931862 9:99200611-99200633 CCACGCGTATGTCTGTGGATGGG - Intergenic
1061766954 9:132887600-132887622 CCCCGTGTGTGCCTGTGGGGAGG + Intronic
1061958206 9:133974523-133974545 TCCCCCGGGTGGATGTGGAGTGG - Intronic
1062033084 9:134370877-134370899 CCCGGCGGGTGGCTGCTGAGGGG + Intronic
1062118743 9:134822725-134822747 CCCCGCGGCTGTCTGAGCTGGGG + Intronic
1062265509 9:135684988-135685010 ACCCACGGGTGTCTGTGGCAGGG + Intergenic
1062542841 9:137049161-137049183 GCCCGTGTGTGTCTGGGGAGGGG - Intronic
1203774098 EBV:63159-63181 CGCCGGGGGTGGCAGTGGAGGGG + Intergenic
1189267985 X:39730934-39730956 CCCCGGGGCTGTCTGCGGATGGG + Intergenic
1195759773 X:108233873-108233895 GCCTGCGTGTGTCTGTGCAGAGG - Intronic
1200043766 X:153388704-153388726 CCCGGCTCCTGTCTGTGGAGGGG - Intergenic