ID: 900431561

View in Genome Browser
Species Human (GRCh38)
Location 1:2605371-2605393
Sequence ATTGCTTGCCACCATCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900431561_900431567 12 Left 900431561 1:2605371-2605393 CCCCCAGGATGGTGGCAAGCAAT 0: 1
1: 0
2: 0
3: 6
4: 146
Right 900431567 1:2605406-2605428 CACCCGCCACCCTCAGTGCCGGG 0: 1
1: 0
2: 5
3: 25
4: 392
900431561_900431573 27 Left 900431561 1:2605371-2605393 CCCCCAGGATGGTGGCAAGCAAT 0: 1
1: 0
2: 0
3: 6
4: 146
Right 900431573 1:2605421-2605443 GTGCCGGGCTCAACCTCCACAGG 0: 1
1: 0
2: 0
3: 6
4: 69
900431561_900431566 11 Left 900431561 1:2605371-2605393 CCCCCAGGATGGTGGCAAGCAAT 0: 1
1: 0
2: 0
3: 6
4: 146
Right 900431566 1:2605405-2605427 GCACCCGCCACCCTCAGTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900431561 Original CRISPR ATTGCTTGCCACCATCCTGG GGG (reversed) Intronic
900431561 1:2605371-2605393 ATTGCTTGCCACCATCCTGGGGG - Intronic
902199600 1:14823506-14823528 TTTGGTTGTCACCAGCCTGGGGG + Intronic
903330742 1:22595898-22595920 AGTGCTTGTGACCATCATGGCGG + Intronic
903752842 1:25638991-25639013 ATTGCTTGATATCATCCTAGAGG + Intronic
908837754 1:68245142-68245164 AATCCTTGCTATCATCCTGGAGG - Intergenic
909069978 1:70982348-70982370 ATTTCTTCCCAACAGCCTGGGGG - Intronic
909361679 1:74767247-74767269 AATGCTTGCCTTCATCCTGAAGG - Intergenic
911319567 1:96396256-96396278 ATCGCTTGAAACCATCCAGGAGG - Intergenic
912230128 1:107783542-107783564 CTTGCTTGGAAGCATCCTGGAGG - Intronic
913127417 1:115805647-115805669 ATTGCATGCCACAATCTTTGGGG + Intergenic
915348907 1:155212604-155212626 ATTCCTGGCCAGCATCCTTGGGG - Intronic
915352096 1:155233230-155233252 ATTCCTGGCCAGCATCCTTGGGG - Intergenic
915944065 1:160136945-160136967 ATTCTTTGCCAGCATCGTGGTGG + Exonic
916074712 1:161193700-161193722 AGTACTTGCCACCATTCCGGGGG + Exonic
916935581 1:169624876-169624898 ATGGCTTGCCACGTTCCAGGTGG + Intronic
918094176 1:181321142-181321164 ATGGCTTGGCACCGTCCTCGAGG - Intergenic
918465621 1:184818754-184818776 ATTCCTGGCATCCATCCTGGAGG - Exonic
921259358 1:213371902-213371924 CCTGCTCGCCATCATCCTGGAGG + Intergenic
921272162 1:213481906-213481928 ATGGTTTGGCACCATCCTTGTGG + Intergenic
923572430 1:235128505-235128527 ATTGCCTCCCACCAGCCTGTGGG - Intronic
924298405 1:242612224-242612246 TTTGCTGGACTCCATCCTGGGGG + Intergenic
1062943341 10:1440181-1440203 AGGGCCTGCCTCCATCCTGGGGG - Intronic
1066459538 10:35601132-35601154 ATTCCTTGCCATCATTCTAGGGG + Intergenic
1067722601 10:48740546-48740568 ACTGAGTACCACCATCCTGGAGG + Intronic
1071336473 10:84604563-84604585 ACAGCTTGACACCATCCTGAAGG + Intergenic
1074383234 10:112996953-112996975 ATCACTTTCCACCATCATGGCGG - Intronic
1075215081 10:120525546-120525568 AGTGTTTGCCTTCATCCTGGAGG - Intronic
1075631967 10:124005913-124005935 ATAGCTTGGTGCCATCCTGGGGG + Intergenic
1077150061 11:1068909-1068931 TTTGCATGCTACTATCCTGGTGG + Intergenic
1079973130 11:27060180-27060202 ATTGTTTAGCACCATCCTGTTGG + Intronic
1081216844 11:40410676-40410698 ATTGCTCATCACCATACTGGTGG + Intronic
1081755765 11:45543286-45543308 ATTCCTTGCCAACATCCCTGAGG + Intergenic
1083153610 11:60809290-60809312 ATTGCTGGCTCCCATCCAGGTGG - Intergenic
1083779682 11:64911337-64911359 ATAGTTTGCCACCAGGCTGGGGG + Intronic
1084297829 11:68224689-68224711 CATGCTCTCCACCATCCTGGTGG + Intergenic
1087224038 11:95578174-95578196 ATTTCTTACAACAATCCTGGAGG + Intergenic
1089149334 11:116352660-116352682 AATGCTGGCCAGCATCCAGGAGG + Intergenic
1092468763 12:8759753-8759775 ATTGCTTAACACTATACTGGAGG - Intronic
1093229101 12:16521061-16521083 ATTGCGTGCTGTCATCCTGGGGG - Intronic
1094715409 12:33009499-33009521 AATGCTTTCCACCATTCTGTAGG + Intergenic
1097720208 12:63011906-63011928 AATGCTTGCAACAATACTGGGGG + Intergenic
1097814897 12:64062203-64062225 ATTGATTGCAGCCATCCTAGTGG + Intronic
1101246192 12:102886017-102886039 ATGGCATGCCAACATCCTGCAGG + Intronic
1101426662 12:104593770-104593792 ATTACTTACCACCAGCCAGGAGG - Intronic
1104323889 12:127777593-127777615 ATTGCTTTTCACCATTCTGAGGG + Intergenic
1107592085 13:41919516-41919538 ATTGCACCCCTCCATCCTGGAGG + Intronic
1108855777 13:54791115-54791137 ATGGCTTGATACCATCCTTGTGG - Intergenic
1111203412 13:84970461-84970483 ATTTTATGCCACCATTCTGGTGG + Intergenic
1113104091 13:106753953-106753975 ATTTCTTCACACCAGCCTGGTGG + Intergenic
1113335065 13:109369736-109369758 GTGCCTTGCCACCATCCTGATGG + Intergenic
1113387337 13:109860761-109860783 ATTCCTTGCCACCTTTGTGGTGG - Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113698749 13:112366951-112366973 CTCCCTTGTCACCATCCTGGTGG - Intergenic
1120292912 14:82600091-82600113 ATTTATTGTCACCATTCTGGAGG + Intergenic
1122346939 14:101066632-101066654 TGTGCTGGCCTCCATCCTGGAGG + Intergenic
1122597261 14:102902337-102902359 CTTTCCTGCCACCATCCAGGTGG + Intronic
1124721508 15:32115013-32115035 ACTGCTGGCCACCAAGCTGGGGG - Intronic
1126503967 15:49381144-49381166 ATGGCTTACCACCATCCCTGTGG - Intronic
1127745373 15:61964958-61964980 ATTGCTTTCCACCACTCTGAAGG + Intronic
1129077985 15:73014012-73014034 AATGCATGCTATCATCCTGGGGG - Intergenic
1134067589 16:11239054-11239076 AATCCTTGGCACCATCCTGTAGG - Intergenic
1135634473 16:24062308-24062330 ATTGCCTGCCACCACCCAGCAGG + Intronic
1136237966 16:28925862-28925884 ATTGCCTGTCACCGTCCGGGTGG - Intronic
1137937702 16:52650213-52650235 ATGGCTTCCCATCATCCTAGTGG - Intergenic
1140840736 16:78836620-78836642 AATTCTTGCTACCATCCTTGAGG + Intronic
1141609979 16:85175748-85175770 AGTGCTTCCCACCCTCCAGGAGG + Intronic
1142173834 16:88635884-88635906 AGTGCTTGTCAGCCTCCTGGCGG + Intergenic
1142853984 17:2719838-2719860 TTTGCTTGCAACCCTCCTGAAGG - Intergenic
1143284557 17:5779576-5779598 ACTGCCTGTCACCATGCTGGAGG - Intronic
1143551127 17:7631178-7631200 TTTGCTTCCCACCTTCCTGCAGG + Exonic
1144214003 17:13038708-13038730 ATGGCTTGGTGCCATCCTGGTGG + Intergenic
1147186079 17:38713679-38713701 ATTTCTTGCCACCTGCCTGCAGG - Intronic
1151448061 17:74180354-74180376 ATTGCTTGCCAGCAAGGTGGAGG - Intergenic
1152017164 17:77758199-77758221 TTTGGTTGCCTCCATCCTGTTGG - Intergenic
1155376591 18:25164750-25164772 ATTGAGTGCCCCCCTCCTGGGGG - Intronic
1158237381 18:55332661-55332683 ATTGCTGTCCACCTTCCAGGAGG + Intronic
1159552054 18:69905423-69905445 ATTGCTGGCCACTCTCCTGTGGG - Intronic
1160044457 18:75373645-75373667 ATTTCATGCCACAATGCTGGAGG - Intergenic
1163491344 19:17618826-17618848 CCAGGTTGCCACCATCCTGGGGG - Intronic
1168212732 19:54902485-54902507 ATTGCTTGAGACGAGCCTGGGGG - Intergenic
932490843 2:72119286-72119308 ATTGCCTGTCACCAGCCAGGTGG - Intergenic
933244234 2:79957348-79957370 TTTGCTTACCAGCATCCTGTTGG + Intronic
942229656 2:173848513-173848535 AATGCTTGGTACCATCCTTGTGG - Intergenic
943477657 2:188378731-188378753 ATGGCTTGGTGCCATCCTGGTGG - Intronic
1175300463 20:57939192-57939214 AGTGCTCAACACCATCCTGGTGG + Intergenic
1177027022 21:15932864-15932886 CTGGCCTGCCACAATCCTGGGGG - Intergenic
1177949002 21:27510455-27510477 AGTGCATCCCACCAACCTGGGGG + Intergenic
1179896228 21:44365253-44365275 ATTGGGTGCCACTGTCCTGGAGG + Intronic
1183474998 22:38031271-38031293 AATCCTTGCAACCATCCTGCAGG - Intronic
950568090 3:13783283-13783305 ACTGGTGGCCACCATCCAGGAGG + Intergenic
951519217 3:23595865-23595887 ATTGCTTGCAAACATATTGGGGG - Intergenic
952659991 3:35833941-35833963 ATTTCTTTCCACTCTCCTGGTGG + Intergenic
956723701 3:72139693-72139715 AGTGCCTGACACCATCCTGGAGG + Intergenic
958131356 3:89429228-89429250 ATTGCTTGGCACAATATTGGAGG - Intronic
959449964 3:106486893-106486915 GAAGCTTGCCACCATCTTGGAGG - Intergenic
960162116 3:114361795-114361817 ATTGCTTGGCACACTTCTGGAGG + Intronic
960810160 3:121620428-121620450 AATTCCTTCCACCATCCTGGAGG - Intronic
961347839 3:126275627-126275649 ATTTCTTGCCAACTTCCTGGTGG - Intergenic
961356872 3:126344916-126344938 ACTGCTTGCCACCAACCTCAGGG + Intronic
964766228 3:160180714-160180736 CTTGCTTGCCAACGTCCTGTTGG - Intergenic
967047819 3:185753839-185753861 ATTGCTTGGCACCATCCCCTTGG + Intronic
967294533 3:187952202-187952224 TTGGCTTGCCACCACCCTGATGG - Intergenic
967620995 3:191633386-191633408 ATTCCTTTCAACAATCCTGGAGG + Intergenic
967911272 3:194544533-194544555 ATGGCTTGGTACCATCCTTGAGG + Intergenic
970824471 4:20254470-20254492 ATTTTTTGTCACCCTCCTGGGGG + Intronic
970846108 4:20539434-20539456 ATTGCTTCTCAACATCCTGAGGG - Exonic
971168796 4:24212066-24212088 ATGGCTTCCCCACATCCTGGAGG + Intergenic
972871207 4:43300924-43300946 TTTGCCTGCCACCATCATGAAGG - Intergenic
973032955 4:45366844-45366866 ATTGCTTGGTGCCATCCTGGTGG + Intergenic
975013281 4:69380699-69380721 ATTGATGGCCTCGATCCTGGAGG - Intronic
975469272 4:74746639-74746661 GCAGCTTGCCACCAACCTGGAGG + Exonic
981292444 4:143091410-143091432 ATTGCTCTCTACCATCCTAGAGG - Intergenic
981519301 4:145645249-145645271 AATGTATGCCAGCATCCTGGAGG - Intronic
982502024 4:156169411-156169433 CTGGCTTGCCAGCACCCTGGAGG + Intergenic
990419468 5:55617342-55617364 CTTGATGGCCTCCATCCTGGAGG - Intergenic
990442272 5:55858912-55858934 ATTGCTGACCACCATTCTTGTGG + Intronic
992747598 5:79835037-79835059 TGTGATTGCCAGCATCCTGGTGG - Intergenic
994400823 5:99276455-99276477 ATGACTTGGCACCATCCTGTTGG + Intergenic
1011782810 6:90809155-90809177 CTTGCCTTCCACCCTCCTGGGGG + Intergenic
1012663046 6:101928442-101928464 AATGCCTCCCACTATCCTGGTGG - Exonic
1014180904 6:118383271-118383293 AGTGCTTCCCACCAGCCAGGTGG + Intergenic
1018328286 6:162698511-162698533 TTTGCAAGCCACCATCCTTGGGG - Intronic
1022117718 7:27276822-27276844 GTGGCCTGCCACCATCTTGGGGG + Intergenic
1023513008 7:40973097-40973119 ATTGCTTGCCCCCAGGTTGGTGG + Intergenic
1023992523 7:45137403-45137425 ATTGCTTGCCACACCCTTGGAGG + Intergenic
1024478601 7:49840467-49840489 ACGGCTTTCCACCATGCTGGGGG - Intronic
1024837196 7:53535557-53535579 ATTGGTTGCCACCAGTCTGTAGG + Intergenic
1029949682 7:104570268-104570290 ATTGCTTACACCCCTCCTGGTGG + Intronic
1031147789 7:118016462-118016484 CTTGCCTGCCATGATCCTGGGGG - Intergenic
1032360328 7:131249315-131249337 ACTGCTGGCCTCCATCCTGGAGG - Intronic
1033626800 7:143118160-143118182 ATTGTTTGCCACTATTCTTGAGG - Intergenic
1034085436 7:148318011-148318033 CATGCTTGCCACCACCTTGGAGG - Intronic
1034169061 7:149048736-149048758 GTTGCTGGGCACCATCTTGGAGG - Intergenic
1038387184 8:27159594-27159616 ATTCCTTAGCACCACCCTGGTGG - Intergenic
1038937839 8:32272149-32272171 TTTGTTTCCCACCATTCTGGAGG + Intronic
1043728021 8:83636534-83636556 ATTGGTTGCCATCATCTTGAAGG + Intergenic
1051368887 9:16341423-16341445 ATTGATTGCAACTATCCTGATGG + Intergenic
1052790187 9:32868303-32868325 CCTGCCTGCCACTATCCTGGTGG + Intergenic
1055007182 9:71521440-71521462 ATTGCTTCCCACAATCCTGAAGG - Intergenic
1056817290 9:89811325-89811347 ACTGCTGGCCACCATCCCAGGGG - Intergenic
1056867441 9:90241752-90241774 ATTGGTTGACACTCTCCTGGTGG + Intergenic
1056920699 9:90785929-90785951 ATTGATTGGCACCATGTTGGGGG - Intergenic
1057997466 9:99831226-99831248 ATTTCTTGCCATCATCCTCAAGG - Intronic
1058509245 9:105698416-105698438 ATATCTTTACACCATCCTGGTGG + Intronic
1059789070 9:117620162-117620184 ATGGCTTAGCACCATCCTGTTGG - Intergenic
1185622464 X:1460980-1461002 ATTGCTTGCCACAGTTCTAGAGG - Intergenic
1186803098 X:13113245-13113267 AATGTCTGCCACCATCCTTGTGG + Intergenic
1192179018 X:68903726-68903748 AGTGCTTGCTTGCATCCTGGTGG + Intergenic
1192554134 X:72076924-72076946 ATTGCTCCCCACCATTCGGGTGG + Intergenic
1196223304 X:113137258-113137280 TTTGCTTGTCACAATGCTGGAGG + Intergenic
1198171058 X:134105641-134105663 ATGGCTTGGTGCCATCCTGGTGG - Intergenic
1199176923 X:144799794-144799816 ATTGCTTGCCACTATACCAGAGG + Intergenic
1201910820 Y:19132084-19132106 ACTGCTTGACAACATCCTGGAGG - Intergenic