ID: 900431561

View in Genome Browser
Species Human (GRCh38)
Location 1:2605371-2605393
Sequence ATTGCTTGCCACCATCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900431561_900431567 12 Left 900431561 1:2605371-2605393 CCCCCAGGATGGTGGCAAGCAAT 0: 1
1: 0
2: 0
3: 6
4: 146
Right 900431567 1:2605406-2605428 CACCCGCCACCCTCAGTGCCGGG 0: 1
1: 0
2: 5
3: 25
4: 392
900431561_900431573 27 Left 900431561 1:2605371-2605393 CCCCCAGGATGGTGGCAAGCAAT 0: 1
1: 0
2: 0
3: 6
4: 146
Right 900431573 1:2605421-2605443 GTGCCGGGCTCAACCTCCACAGG 0: 1
1: 0
2: 0
3: 6
4: 69
900431561_900431566 11 Left 900431561 1:2605371-2605393 CCCCCAGGATGGTGGCAAGCAAT 0: 1
1: 0
2: 0
3: 6
4: 146
Right 900431566 1:2605405-2605427 GCACCCGCCACCCTCAGTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900431561 Original CRISPR ATTGCTTGCCACCATCCTGG GGG (reversed) Intronic