ID: 900434093

View in Genome Browser
Species Human (GRCh38)
Location 1:2619220-2619242
Sequence TGGGGTCATCTGACCTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900434093_900434097 -8 Left 900434093 1:2619220-2619242 CCAACCTAGGTCAGATGACCCCA 0: 1
1: 0
2: 1
3: 14
4: 139
Right 900434097 1:2619235-2619257 TGACCCCAGGCAAACAGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900434093 Original CRISPR TGGGGTCATCTGACCTAGGT TGG (reversed) Intronic
900434093 1:2619220-2619242 TGGGGTCATCTGACCTAGGTTGG - Intronic
902385238 1:16072519-16072541 TGGGGTGAACAGACCAAGGTGGG + Intronic
903799854 1:25958553-25958575 TGGTGTCCTCTGATCTAGGAAGG - Intergenic
905533004 1:38696810-38696832 GGGGGTCATCTGATCCAGGCTGG + Intergenic
912527684 1:110296653-110296675 TAGGGTCGTCTGACCTTGGCTGG + Intergenic
912561045 1:110551757-110551779 TGGGGACATCTGAGGCAGGTAGG + Intergenic
912645642 1:111389345-111389367 TGGGCTCATCAGACCAAGGCTGG + Intergenic
912654965 1:111477767-111477789 TGTGGTCATCTTACCTTGGCTGG - Exonic
914221197 1:145683467-145683489 TGGAGTCATCTCACCAATGTAGG + Intronic
916153676 1:161822743-161822765 TAGGGTCACTTGACCTAGTTAGG + Intronic
917700706 1:177577926-177577948 TGGGATCAACTGACCTAGGTAGG + Intergenic
922252283 1:223860490-223860512 TGGGCTCATCTGACCCAGCTCGG - Intergenic
924951678 1:248890269-248890291 TGGGGACTTCTGACCTAGTTAGG - Intergenic
1062911736 10:1216227-1216249 TCGGGGCATCAGACCGAGGTTGG + Intronic
1064261341 10:13788695-13788717 CGGGATCATCTGAGCTAGTTTGG - Intronic
1067744375 10:48924215-48924237 TGGGGTCACCCGACCTTGGCAGG + Intronic
1068962869 10:62882926-62882948 TGGGGACCTCTGACCTAAGGTGG + Intronic
1070790413 10:79185963-79185985 TGGGGTCATCGGGCCTGGCTGGG - Intronic
1072085831 10:92078176-92078198 TGGGGTTATATGACCTTGGGCGG - Intronic
1073562754 10:104510874-104510896 TGGGGTCATCTGAGATCAGTGGG + Intergenic
1073937429 10:108650323-108650345 TGTGGGCATGTGACCTAAGTTGG + Intergenic
1074124192 10:110515228-110515250 TAGGGACATCTGACCTAGTCTGG - Intergenic
1076769865 10:132656972-132656994 TGGGGTCCGATGACCTAGTTGGG + Intronic
1077347970 11:2073093-2073115 TGGGGTCAACTGACCCTGGCCGG - Intergenic
1081601552 11:44498698-44498720 TGGGCTCAACTGACCTTGGCTGG + Intergenic
1081617104 11:44597522-44597544 TGGGGTCATCAGACCTACAGAGG + Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1083211051 11:61186497-61186519 TGGGGTCATGTGACTTAAGATGG - Intergenic
1083613305 11:64014614-64014636 TGGTGTGGTCTGCCCTAGGTGGG + Intronic
1083889434 11:65588623-65588645 CTGGGTCATCTGACCTGTGTCGG - Intronic
1089455171 11:118621642-118621664 TGGGGTCCTCTGACCTTCTTTGG + Intronic
1091273495 11:134333733-134333755 TGCGGTCACCCCACCTAGGTGGG - Intronic
1101039158 12:100736687-100736709 TGAGGTCATCTGGACTAGGGTGG + Intronic
1101061474 12:100976970-100976992 TGGGGTCATAAAACCTATGTTGG + Intronic
1101717951 12:107327321-107327343 TGAGGTCATCAGGCTTAGGTGGG + Intronic
1101810523 12:108103843-108103865 TGGGGTCACCTGATCCAGGCTGG - Intergenic
1102579456 12:113877052-113877074 TGGGGGCATGGGACCTTGGTGGG - Intronic
1102588890 12:113942560-113942582 TGGGGGCATCTGATCAATGTAGG - Intronic
1103825560 12:123735384-123735406 TGCAGTCATCTGCCCTTGGTCGG - Intronic
1103981958 12:124742471-124742493 TGAGGACATCTGGCCTGGGTGGG - Intergenic
1104151879 12:126091617-126091639 TGGGGACATCTGAGCTGGGATGG + Intergenic
1104436679 12:128762421-128762443 TGTGGACATCTGATCAAGGTTGG - Intergenic
1104801856 12:131559818-131559840 TGGGGTCATGTGACTGGGGTGGG - Intergenic
1105694986 13:22879223-22879245 AGGGGTGAACTGGCCTAGGTCGG - Intergenic
1107988952 13:45800557-45800579 TGGGGCCATCTGAACAAGGAAGG - Intronic
1118837180 14:69485404-69485426 TGGCCTGATCTGACCTAGCTGGG - Intronic
1119058513 14:71448850-71448872 AGGGGTCAACTGGCCCAGGTTGG + Intronic
1120849496 14:89156570-89156592 TAGGGTCGTCTGACCTTGGCTGG - Exonic
1122114100 14:99519018-99519040 TGGGCCCATCTGCCCTAAGTGGG - Intronic
1123063200 14:105603672-105603694 TGGGTTCAGCTGGCCTAGGTTGG - Intergenic
1125927587 15:43575812-43575834 TGGGCTCATCTGATCTTGCTTGG - Intronic
1125940730 15:43675377-43675399 TGGGCTCATCTGATCTTGCTTGG - Intergenic
1128634385 15:69293865-69293887 CAGGGCCATCTGACCTAGGGAGG - Intergenic
1133658148 16:7887246-7887268 GGTGGACATCTGACCTAAGTTGG - Intergenic
1138441140 16:57035665-57035687 TGGGGGCATCTGACCTAGTCTGG - Intronic
1141245284 16:82301593-82301615 TGAGGTCATGTGACCTGTGTTGG - Intergenic
1141550053 16:84800840-84800862 TGGGGTCACCTGATCTATGCTGG + Intergenic
1144129916 17:12236559-12236581 TAGGGTCGTCTGACCTTGGTTGG - Intergenic
1147319922 17:39639918-39639940 AGGGATCATCTGACCCAGGCTGG - Intronic
1152099599 17:78293355-78293377 TAGGGCCATCTGACCCGGGTTGG - Intergenic
1152186826 17:78862367-78862389 TGGAGTCATCTGACCAAGGCTGG + Intronic
1152193500 17:78902797-78902819 TGGGGACCCCTGACCTAGGCTGG - Intronic
1152928244 17:83097702-83097724 TGGGGGCATCTGACCTGGGCAGG + Intergenic
1153673199 18:7432259-7432281 TCGGGTCATCAGAGCTGGGTTGG - Intergenic
1155517469 18:26637748-26637770 TGGGGTCCACTGACCTGGGCTGG + Intronic
1156887572 18:42152945-42152967 TGAGGTGATCTCACATAGGTAGG - Intergenic
1157295388 18:46438384-46438406 TGGGATGGTCTGCCCTAGGTGGG - Intronic
1158478229 18:57799213-57799235 TGGAGTCTTTTGACCTGGGTTGG - Intronic
1158739550 18:60124303-60124325 TAGGGTCATCTGACCTTGGCTGG - Intergenic
1159114505 18:64098805-64098827 TGGGGTCATCTAAACCAGGCTGG - Intergenic
1160866617 19:1259169-1259191 TGGGGGGATCTGGCCTTGGTTGG + Intergenic
1165586125 19:36917144-36917166 TGTGTTCAGCTGATCTAGGTGGG + Intronic
1166348619 19:42182771-42182793 TGGAGTCATCTGAAGTGGGTAGG + Intronic
1166701492 19:44884718-44884740 AGGGGGCATCTGACCCAGGCTGG + Intronic
1167505931 19:49871103-49871125 TGGGCTCTGCTGGCCTAGGTGGG - Intronic
926095243 2:10077164-10077186 TGGGGTCATTTGGACCAGGTTGG - Intronic
929217950 2:39436468-39436490 TGGGGTCGTCCGCTCTAGGTTGG - Intronic
934663680 2:96156247-96156269 TGGCACCATCTGACCTTGGTTGG + Intergenic
936061422 2:109297784-109297806 TGGGGAGAGCTGACCTAGTTGGG - Intronic
938242224 2:129752222-129752244 TGGGGTCATTTGACCTGAGGAGG + Intergenic
939997206 2:148931031-148931053 AAGTGTCATCTGACCTAGGAGGG - Intronic
1170579702 20:17688822-17688844 TGGGGAGATCTAACCCAGGTAGG - Intergenic
1170926620 20:20730554-20730576 GGGGTTCATCTGATCTGGGTTGG + Intergenic
1172160793 20:32866639-32866661 TGAGCTCATCTGACCGAGATGGG + Intronic
1172398644 20:34629572-34629594 AGGAGTCAGCTGATCTAGGTTGG - Intronic
1172601120 20:36183606-36183628 TGGGGCCATCTGTGCTAGGCAGG - Intronic
1173133835 20:40421649-40421671 AGGGGTTAACTGACCTAGGCTGG - Intergenic
1177965928 21:27726100-27726122 TGTGGTCATCTGAGCTAGTAGGG + Intergenic
1178830934 21:36055874-36055896 TGGTGTCATTTGCCCTAGGAAGG - Intronic
1179140852 21:38723606-38723628 GGGGGTCAGCTAATCTAGGTTGG - Intergenic
1179394517 21:41026102-41026124 TGGGCTCATCTGATCTCGGCTGG + Intergenic
1179835583 21:44029961-44029983 AAGTGTCATCTGACCTAAGTAGG - Intronic
1184874300 22:47263356-47263378 TTGGATCATCTGGCCTAGGCTGG - Intergenic
949492669 3:4604655-4604677 TGGGGTCATCTTAGCTGGGAAGG + Intronic
950179721 3:10902647-10902669 TGGGGTCAGCAGACCCAGCTTGG - Intronic
951352596 3:21624676-21624698 TTGGGTCTTCTGAGCTTGGTGGG - Intronic
953927008 3:46987783-46987805 TGGAGTCACCTGTCCTGGGTGGG - Intronic
954190661 3:48958041-48958063 AGGGGTAAACTGACGTAGGTTGG + Intronic
956327313 3:68068510-68068532 TGGGGTCATATTACTTAAGTAGG + Intronic
957345252 3:78952319-78952341 TGGCGACATCTGTCCAAGGTGGG + Intronic
958833159 3:99114203-99114225 TGGGGTCCTCTTGTCTAGGTAGG + Intergenic
959270845 3:104207913-104207935 AGGGGTCATCTGCTCCAGGTTGG - Intergenic
959380072 3:105630934-105630956 TGGGATTATCTGACCTGGTTTGG - Intergenic
961559943 3:127721787-127721809 TGGGGACATCTGACCAGGGCAGG - Intronic
967461743 3:189755984-189756006 TGGGGTGAGCAGACCTAGCTGGG + Intronic
971315737 4:25566361-25566383 AGGGGTCATCTGACCTCTATTGG + Intergenic
981584646 4:146287689-146287711 TGTGATCAGCTGTCCTAGGTAGG + Intronic
986511227 5:8508398-8508420 TGGTGTCATCTTACCTAGCTGGG + Intergenic
988438936 5:31209968-31209990 AGTGGTCATATGACCTAAGTTGG - Intronic
992992069 5:82294008-82294030 TGGGGTCCCCTGAACTATGTTGG + Intronic
993661382 5:90640596-90640618 TGGGGTCATCTTCCATAAGTGGG + Intronic
995142070 5:108746044-108746066 TGTGGACATCAAACCTAGGTGGG - Intergenic
996164207 5:120205205-120205227 TGGGGTCAACAGACCTAAGGGGG - Intergenic
997520129 5:134517977-134517999 AGGGGTGAACTGACCCAGGTCGG + Intergenic
998959069 5:147465681-147465703 TCGGGTCATATGCCCTGGGTCGG - Intronic
1001936279 5:175708111-175708133 TGGGGTCCTCAGGCCTAGGGCGG + Intergenic
1002302321 5:178264171-178264193 TGGGGGCATCTGAATAAGGTTGG + Intronic
1004744534 6:18496887-18496909 TGGAGTGATGTGACTTAGGTTGG - Intergenic
1005646601 6:27845340-27845362 TTGAGGCATCTGCCCTAGGTAGG + Intronic
1006596327 6:35195069-35195091 TGTGGTCATCTTACCAAGCTGGG - Intergenic
1007705318 6:43787333-43787355 TGGGGGCATCTGATCTAGCTTGG + Intergenic
1008253264 6:49266350-49266372 TGAGGTCATCTAACCCTGGTTGG - Intergenic
1009467041 6:63984338-63984360 TGGAGTCATGTAACGTAGGTTGG + Intronic
1010301298 6:74263400-74263422 TGGGGACATTTGACATAGGATGG + Intergenic
1011049281 6:83126613-83126635 TGGGGTGACCTGACCTACGCTGG + Intronic
1012989339 6:105909139-105909161 TGGTGTTATCTGACCTTGGTTGG - Intergenic
1014941574 6:127446650-127446672 TGGGATCAGCTGACCTCGGACGG + Exonic
1019015737 6:168878537-168878559 TGGGGAGTTCTGACCTGGGTCGG - Intergenic
1019015901 6:168879066-168879088 TGGGGAGTTCTGACCTGGGTGGG - Intergenic
1021829524 7:24590457-24590479 TGGGGTGTTCTGAACTAGGCAGG + Intronic
1023557964 7:41443019-41443041 TGGGGTCACCAGCCCTTGGTTGG - Intergenic
1027503093 7:78979688-78979710 TGGGCTCATCTGACCAGTGTTGG + Intronic
1034099478 7:148438462-148438484 AGGGGTGAACTGACCCAGGTTGG + Intergenic
1034994138 7:155567495-155567517 ATGGGCCATCTGACCTAGCTGGG - Intergenic
1037402484 8:18506850-18506872 TGGGGTCAGCTGGCCTGTGTTGG - Intergenic
1039970319 8:42316421-42316443 TGGGGCCAGCTGACCTAGTGAGG + Intronic
1044894567 8:96877800-96877822 TGGGGTCACTTAACCTAGGTCGG - Intronic
1048733551 8:137471712-137471734 TGGGATCATCTGAACTACGTGGG + Intergenic
1049265940 8:141667981-141668003 TGGCGTGACCTGACTTAGGTTGG + Intergenic
1056550390 9:87648638-87648660 TAGGGGCATCTGCCCAAGGTGGG + Intronic
1057415617 9:94859723-94859745 TGGGGTCAGCTAACCTGTGTTGG + Intronic
1057476744 9:95409273-95409295 TGGGGTCATCTGCCCTGAGAGGG - Intergenic
1060175521 9:121494698-121494720 AGGGGTAAACTGACTTAGGTTGG + Intergenic
1061048312 9:128179402-128179424 TGGGCTCTTCTGAGCTAGGAAGG + Exonic
1061742577 9:132717759-132717781 TGGGGTCACGTGCTCTAGGTCGG + Intergenic
1186710341 X:12188090-12188112 TGGAGTCAGCTGACCTAGACTGG + Intronic
1187008758 X:15258119-15258141 TGGGGTGGACTGACCTAGGTAGG + Intronic
1187739828 X:22343546-22343568 TGGGGTCAGCTGATCTGGGCTGG + Intergenic
1192938705 X:75889648-75889670 TAGGGTCGTCTGACCTTGGCTGG + Intergenic
1193623955 X:83794078-83794100 TGGGCTGATCTGATCCAGGTTGG - Intergenic
1195200499 X:102545932-102545954 TAGGGTTATCTGACCTTGGCTGG - Intergenic
1195287343 X:103397941-103397963 TGGGGTCAGCGGGCCTAGGAGGG + Intergenic
1195615740 X:106910459-106910481 TTGGGTGATCTGCCCGAGGTGGG + Intronic
1196996654 X:121390764-121390786 TGGGTTCATCTCACCTAGACTGG - Intergenic
1199900515 X:152167817-152167839 TAGAGTCATCTGATCTAGATGGG + Exonic