ID: 900435450

View in Genome Browser
Species Human (GRCh38)
Location 1:2628797-2628819
Sequence CACGGGACCACGGCGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900435450_900435465 5 Left 900435450 1:2628797-2628819 CCCCTTCCCGCCGTGGTCCCGTG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 900435465 1:2628825-2628847 ACCCGGCCTTGAGCGGGGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 113
900435450_900435469 9 Left 900435450 1:2628797-2628819 CCCCTTCCCGCCGTGGTCCCGTG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 900435469 1:2628829-2628851 GGCCTTGAGCGGGGCGGGGGCGG 0: 1
1: 0
2: 5
3: 67
4: 682
900435450_900435472 22 Left 900435450 1:2628797-2628819 CCCCTTCCCGCCGTGGTCCCGTG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 900435472 1:2628842-2628864 GCGGGGGCGGCAGGACCCTCAGG 0: 1
1: 1
2: 3
3: 28
4: 267
900435450_900435464 4 Left 900435450 1:2628797-2628819 CCCCTTCCCGCCGTGGTCCCGTG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 900435464 1:2628824-2628846 GACCCGGCCTTGAGCGGGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 132
900435450_900435471 13 Left 900435450 1:2628797-2628819 CCCCTTCCCGCCGTGGTCCCGTG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 900435471 1:2628833-2628855 TTGAGCGGGGCGGGGGCGGCAGG 0: 1
1: 0
2: 5
3: 49
4: 613
900435450_900435461 0 Left 900435450 1:2628797-2628819 CCCCTTCCCGCCGTGGTCCCGTG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 900435461 1:2628820-2628842 ACCTGACCCGGCCTTGAGCGGGG 0: 1
1: 0
2: 0
3: 5
4: 69
900435450_900435459 -2 Left 900435450 1:2628797-2628819 CCCCTTCCCGCCGTGGTCCCGTG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 900435459 1:2628818-2628840 TGACCTGACCCGGCCTTGAGCGG 0: 1
1: 0
2: 1
3: 6
4: 78
900435450_900435463 3 Left 900435450 1:2628797-2628819 CCCCTTCCCGCCGTGGTCCCGTG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 900435463 1:2628823-2628845 TGACCCGGCCTTGAGCGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 75
900435450_900435467 6 Left 900435450 1:2628797-2628819 CCCCTTCCCGCCGTGGTCCCGTG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 900435467 1:2628826-2628848 CCCGGCCTTGAGCGGGGCGGGGG 0: 1
1: 0
2: 1
3: 24
4: 199
900435450_900435460 -1 Left 900435450 1:2628797-2628819 CCCCTTCCCGCCGTGGTCCCGTG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 900435460 1:2628819-2628841 GACCTGACCCGGCCTTGAGCGGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900435450 Original CRISPR CACGGGACCACGGCGGGAAG GGG (reversed) Intronic
900435450 1:2628797-2628819 CACGGGACCACGGCGGGAAGGGG - Intronic
900513507 1:3070875-3070897 CAGCGGAGCGCGGCGGGAAGGGG - Intronic
903501279 1:23801177-23801199 CACGGGACTAAGGCAGGAGGGGG + Intergenic
911362984 1:96902100-96902122 CACGGAACAAAGGAGGGAAGGGG - Intergenic
913486139 1:119333984-119334006 CAGGAGCCCACGGCGGGAGGAGG - Intergenic
921219922 1:212966148-212966170 CACAGGAGCACGGAGGGAAAAGG - Intronic
922099822 1:222471159-222471181 GGCGGGAACCCGGCGGGAAGAGG - Intergenic
923312591 1:232749229-232749251 CACGGAACAAAGGAGGGAAGGGG - Intergenic
923896392 1:238275143-238275165 CACGGAACAAAGGAGGGAAGGGG + Intergenic
924740367 1:246791286-246791308 CAGGGGAGCAGGGCGGGGAGAGG - Intergenic
1065528868 10:26648882-26648904 CAGGGGAAAACCGCGGGAAGGGG - Intergenic
1069090771 10:64196854-64196876 CAGGAGCCCACGGCGGGAAGAGG + Intergenic
1077093841 11:791124-791146 CGCCTGGCCACGGCGGGAAGGGG + Exonic
1084486702 11:69452358-69452380 CAGGGAACCAAGGCAGGAAGTGG + Intergenic
1084679762 11:70660023-70660045 CACAGGACCCCGGGAGGAAGTGG + Intronic
1084970908 11:72771654-72771676 CTGGGGACCAGGGAGGGAAGGGG - Intronic
1089207102 11:116773045-116773067 GGCGGGGCCACGGCCGGAAGTGG + Intergenic
1091591319 12:1844462-1844484 GGCGGTACCACAGCGGGAAGCGG + Exonic
1095493142 12:42757292-42757314 CAGGGGATCACTGGGGGAAGGGG - Intergenic
1099228120 12:79993306-79993328 CAGGAGCCCACGGCGGGGAGAGG + Intergenic
1118197551 14:63641674-63641696 CGCGGGAGCGCGGAGGGAAGTGG - Intronic
1128768773 15:70266699-70266721 GGTGGGACCACAGCGGGAAGGGG - Intergenic
1129087537 15:73111702-73111724 CACTGGAGCACGGGAGGAAGAGG - Intronic
1129447118 15:75626103-75626125 CACGGGCCCAAGAGGGGAAGGGG - Intronic
1132475934 16:138262-138284 CCCGGCCCCACGGCGGGATGCGG - Exonic
1134203926 16:12221830-12221852 CACGGGATCATGCGGGGAAGAGG - Intronic
1137603824 16:49774238-49774260 CACTGGCCCAGGGCTGGAAGGGG - Intronic
1138547079 16:57726290-57726312 CTGGGGGCCACGGCGGGCAGGGG + Intronic
1139529124 16:67533656-67533678 AACTGGACCAGGGTGGGAAGAGG + Intronic
1140379002 16:74469643-74469665 AACGGGACGACGCAGGGAAGAGG + Intronic
1142488866 17:264654-264676 CACAGGACCAACGCAGGAAGAGG + Intronic
1147238448 17:39074759-39074781 CACTGGGCCAGGGCGGGGAGGGG - Intronic
1149038126 17:52157817-52157839 GACGGGAAAACGGGGGGAAGGGG + Exonic
1149848528 17:60021502-60021524 CTCTGGACCAGGGTGGGAAGGGG + Intergenic
1149861641 17:60125022-60125044 CTCTGGACCAGGGTGGGAAGGGG - Intergenic
1152494456 17:80661128-80661150 CACGGGACCAGGATTGGAAGTGG + Intronic
1155149276 18:23110042-23110064 AATGGGACCAGGGCAGGAAGGGG + Intergenic
1159540903 18:69774350-69774372 CAGGGGAAAAGGGCGGGAAGGGG + Intronic
1160236645 18:77090889-77090911 CACAGGACCAGGGCCGGACGGGG + Intronic
1161281716 19:3449148-3449170 CACGGGCCCCTGGCGGGGAGGGG + Intronic
1162739004 19:12763327-12763349 CAAGGGTCCACGGCGAGAATTGG + Exonic
1163015506 19:14451755-14451777 GAGGGGACCACAGCGGGGAGGGG - Intronic
1164188508 19:22894173-22894195 AACGTGGCCACCGCGGGAAGAGG - Intergenic
929911020 2:46089584-46089606 CCCGGGGCCAGGGCGTGAAGGGG - Intronic
932764554 2:74461653-74461675 CAGGGGCCCAAGGCGGGATGAGG + Exonic
933779497 2:85791803-85791825 CACGGGACCAGGGCGGCAGAGGG - Intergenic
939829719 2:147057238-147057260 CACTGGGCCACCGAGGGAAGGGG - Intergenic
945556611 2:211283717-211283739 AACGGGAACAGGGAGGGAAGGGG + Intergenic
1176108265 20:63399537-63399559 CTCGGGATCACGGCAGGAAGGGG + Intergenic
1180048063 21:45318757-45318779 CACAGGGCCAGGGCAGGAAGGGG - Intergenic
1182321309 22:29480045-29480067 CAGGGGACCGAGGAGGGAAGGGG - Intergenic
1182355242 22:29719905-29719927 CAGGGGCCGGCGGCGGGAAGGGG + Intergenic
958977279 3:100682361-100682383 CAGGGGACCGGGGTGGGAAGTGG + Intronic
976431328 4:84966249-84966271 GACGGGACCGCGGCGGGCCGGGG + Exonic
980035774 4:127881218-127881240 CACGAGACCGCTGTGGGAAGGGG + Intronic
982347152 4:154372185-154372207 CACGGGACAATGGGGGGATGGGG + Intronic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
998450618 5:142231807-142231829 CAGGGCACCACAGCAGGAAGAGG - Intergenic
999732107 5:154482640-154482662 CACGGGACTGCGGCGGGAGAAGG - Intergenic
1006470120 6:34224017-34224039 GGCGGGGCCACGGCGGGCAGAGG - Intergenic
1013963418 6:115928162-115928184 CAGGAGCCCACGGCGGGGAGGGG + Intergenic
1015381105 6:132570396-132570418 CCCGGGATCCCGGCGAGAAGGGG - Exonic
1019301348 7:305645-305667 CACGGAACCACGGCAGGACGTGG + Intergenic
1020082912 7:5296283-5296305 CACGGGCGCAGGGTGGGAAGAGG - Intronic
1020274436 7:6615846-6615868 CCCGGGACCATCGCGGGCAGCGG - Exonic
1022721205 7:32943080-32943102 CGCGGGGCGGCGGCGGGAAGGGG - Intergenic
1025211357 7:57020905-57020927 CACGGGCGCAGGGTGGGAAGAGG + Intergenic
1025660596 7:63555942-63555964 CACGGGCGCAGGGTGGGAAGAGG - Intergenic
1025994062 7:66517232-66517254 CACGGGGCCAGGGCTGGGAGGGG - Intergenic
1026985672 7:74553932-74553954 CACGGGGCCAGGGCTGGGAGGGG - Intronic
1030055612 7:105581525-105581547 CACGTGACCGCGCCGGGTAGAGG - Intronic
1042859234 8:73295803-73295825 CTGGGGACCACGGCGGGGGGAGG + Intronic
1047966657 8:130050249-130050271 GAGGGGAACACGGGGGGAAGAGG + Intergenic
1049857960 8:144875407-144875429 CAGGAGCCCACGGCGGGCAGGGG - Intergenic
1061753785 9:132798860-132798882 CACGGGCCCGCGGTGGGGAGTGG - Intronic
1198394009 X:136205289-136205311 GAGGGGACCAGGGAGGGAAGAGG + Intronic