ID: 900437604

View in Genome Browser
Species Human (GRCh38)
Location 1:2639015-2639037
Sequence CTGGGTCTCCACATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2066
Summary {0: 1, 1: 8, 2: 66, 3: 533, 4: 1458}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900437598_900437604 0 Left 900437598 1:2638992-2639014 CCTGGTTCACAGACAGCTTCTCA 0: 1
1: 0
2: 3
3: 42
4: 321
Right 900437604 1:2639015-2639037 CTGGGTCTCCACATGGTGGAGGG 0: 1
1: 8
2: 66
3: 533
4: 1458
900437594_900437604 28 Left 900437594 1:2638964-2638986 CCAGCTCGCTCTCTAGTGAGGAT 0: 1
1: 0
2: 0
3: 0
4: 46
Right 900437604 1:2639015-2639037 CTGGGTCTCCACATGGTGGAGGG 0: 1
1: 8
2: 66
3: 533
4: 1458
900437597_900437604 4 Left 900437597 1:2638988-2639010 CCTTCCTGGTTCACAGACAGCTT 0: 1
1: 0
2: 4
3: 55
4: 321
Right 900437604 1:2639015-2639037 CTGGGTCTCCACATGGTGGAGGG 0: 1
1: 8
2: 66
3: 533
4: 1458
900437596_900437604 5 Left 900437596 1:2638987-2639009 CCCTTCCTGGTTCACAGACAGCT 0: 2
1: 1
2: 13
3: 70
4: 294
Right 900437604 1:2639015-2639037 CTGGGTCTCCACATGGTGGAGGG 0: 1
1: 8
2: 66
3: 533
4: 1458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900437604 Original CRISPR CTGGGTCTCCACATGGTGGA GGG Intronic
Too many off-targets to display for this crispr