ID: 900438464

View in Genome Browser
Species Human (GRCh38)
Location 1:2642215-2642237
Sequence GACCTGGATTTACCTCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900438456_900438464 9 Left 900438456 1:2642183-2642205 CCACTGCTCTTCTCCCTGGGCCT 0: 1
1: 1
2: 2
3: 97
4: 1298
Right 900438464 1:2642215-2642237 GACCTGGATTTACCTCCTCATGG 0: 1
1: 0
2: 0
3: 7
4: 115
900438451_900438464 23 Left 900438451 1:2642169-2642191 CCTGGCATCCTTGCCCACTGCTC 0: 1
1: 0
2: 1
3: 33
4: 353
Right 900438464 1:2642215-2642237 GACCTGGATTTACCTCCTCATGG 0: 1
1: 0
2: 0
3: 7
4: 115
900438455_900438464 10 Left 900438455 1:2642182-2642204 CCCACTGCTCTTCTCCCTGGGCC 0: 1
1: 0
2: 3
3: 48
4: 607
Right 900438464 1:2642215-2642237 GACCTGGATTTACCTCCTCATGG 0: 1
1: 0
2: 0
3: 7
4: 115
900438449_900438464 30 Left 900438449 1:2642162-2642184 CCCAAGGCCTGGCATCCTTGCCC 0: 1
1: 0
2: 0
3: 19
4: 271
Right 900438464 1:2642215-2642237 GACCTGGATTTACCTCCTCATGG 0: 1
1: 0
2: 0
3: 7
4: 115
900438460_900438464 -4 Left 900438460 1:2642196-2642218 CCCTGGGCCTCGGATCAGGGACC 0: 1
1: 0
2: 2
3: 31
4: 143
Right 900438464 1:2642215-2642237 GACCTGGATTTACCTCCTCATGG 0: 1
1: 0
2: 0
3: 7
4: 115
900438450_900438464 29 Left 900438450 1:2642163-2642185 CCAAGGCCTGGCATCCTTGCCCA 0: 1
1: 0
2: 2
3: 44
4: 456
Right 900438464 1:2642215-2642237 GACCTGGATTTACCTCCTCATGG 0: 1
1: 0
2: 0
3: 7
4: 115
900438461_900438464 -5 Left 900438461 1:2642197-2642219 CCTGGGCCTCGGATCAGGGACCT 0: 1
1: 0
2: 0
3: 32
4: 222
Right 900438464 1:2642215-2642237 GACCTGGATTTACCTCCTCATGG 0: 1
1: 0
2: 0
3: 7
4: 115
900438452_900438464 15 Left 900438452 1:2642177-2642199 CCTTGCCCACTGCTCTTCTCCCT 0: 1
1: 1
2: 9
3: 98
4: 931
Right 900438464 1:2642215-2642237 GACCTGGATTTACCTCCTCATGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900438464 Original CRISPR GACCTGGATTTACCTCCTCA TGG Intronic
900425394 1:2576030-2576052 GCCCTGGGTTCACTTCCTCAAGG + Intergenic
900438464 1:2642215-2642237 GACCTGGATTTACCTCCTCATGG + Intronic
901772277 1:11536560-11536582 GACCCGGACTTCCTTCCTCAAGG + Exonic
901776143 1:11561500-11561522 GCCCTGGATTTTCCATCTCAGGG - Intergenic
903326346 1:22570953-22570975 GACCAGGACCCACCTCCTCATGG - Intronic
907663703 1:56416196-56416218 GACCTGGGTTTACTCCTTCAAGG - Intergenic
915285708 1:154850654-154850676 GAGGTGGAATAACCTCCTCAAGG - Intronic
1067060530 10:43076004-43076026 TCCCTGGCTTTTCCTCCTCAAGG + Intergenic
1067214618 10:44292493-44292515 GACTTGGATTCAGCTCCACATGG + Intergenic
1067297884 10:44985075-44985097 AACCTGGTTTTTCCTCCTGAGGG - Intronic
1075580564 10:123614882-123614904 GACCTGGCTCTACCTCAGCATGG + Intergenic
1076998392 11:310524-310546 GACCTGGCTTTAGTTCCTCGGGG + Intronic
1077000350 11:319234-319256 GACCTGGCTTTAGTTCCTCGGGG - Intergenic
1085617779 11:78014652-78014674 AACCTGGCTTTGCCTCCTAATGG - Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1092452597 12:8616924-8616946 GACATGGAGTTATCTCTTCAAGG + Intergenic
1100378705 12:94042029-94042051 TTCCTGGATTCAACTCCTCAGGG + Intergenic
1101815775 12:108145033-108145055 GGCCTGGATTTCACTGCTCAGGG - Intronic
1111359427 13:87155723-87155745 CACCTGGATTTAGCTCCAAATGG - Intergenic
1112265315 13:97918411-97918433 GATCTGATTTTATCTCCTCAAGG - Intergenic
1112750287 13:102576319-102576341 CACCTGGATTTTCATCCTTAGGG - Intergenic
1113949987 13:114066451-114066473 GACCTGGCCTTTGCTCCTCATGG + Intronic
1120667488 14:87323988-87324010 CTCCTGGATGTACCACCTCATGG - Intergenic
1122640143 14:103155213-103155235 GACCTGGGTTGAACTCTTCATGG - Intergenic
1122730735 14:103795444-103795466 AACTTAGTTTTACCTCCTCAAGG - Intronic
1125507380 15:40274564-40274586 GTCCTGGCTTTCCCTGCTCATGG - Intronic
1127482879 15:59393261-59393283 GCCCTGGATTAACTTCCTCAAGG - Intronic
1127620373 15:60727915-60727937 GACCTGGCTTCACCTCCTCCTGG + Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1128537758 15:68503540-68503562 GACCTGGATTTTCCTCCCTCTGG + Intergenic
1130931331 15:88430243-88430265 GTCCTGGACTCACCTCCTCCAGG - Intergenic
1131072641 15:89475760-89475782 GACTTGGATTTAACTGCTCTGGG - Intronic
1138047707 16:53743040-53743062 TACCTGGATTCACTTACTCATGG - Intronic
1139114859 16:63937698-63937720 GGCCTGGATTTAACTCTGCAGGG - Intergenic
1139286228 16:65816909-65816931 GACCTGGATTCAAATCCTGATGG - Intergenic
1140221357 16:73046917-73046939 CTCCTGGATTCACCTGCTCACGG + Intronic
1143654474 17:8285831-8285853 GACCTGGCGTGACCTCCTCTGGG + Intergenic
1144627473 17:16851712-16851734 GAGCTGAACTCACCTCCTCATGG + Intergenic
1144878968 17:18421007-18421029 GAGCTGAACTCACCTCCTCATGG - Intergenic
1145153268 17:20523387-20523409 GAGCTGAACTCACCTCCTCATGG + Intergenic
1149032775 17:52102941-52102963 GACATGCATATACATCCTCAAGG + Intronic
1151386651 17:73759199-73759221 GACATGGCATTCCCTCCTCAGGG - Intergenic
1152512446 17:80799668-80799690 GACCTGGTTTTACTTCCTGCAGG - Intronic
1155523725 18:26695543-26695565 TACCTGGACTTTCCTCCACATGG + Intergenic
1156823605 18:41403642-41403664 GACATGGACTTTGCTCCTCAAGG + Intergenic
1159928022 18:74285914-74285936 CACCTGCAATTACCTCCTTATGG - Intronic
933808694 2:86018437-86018459 GACCTGGCTTTCATTCCTCAGGG + Intergenic
934097278 2:88618389-88618411 GACCTGGGTGTACATCCCCAAGG + Intronic
936273581 2:111071208-111071230 GATCTTGAATAACCTCCTCAGGG + Intronic
937292960 2:120793149-120793171 GACCTGGGTGAACCTCCTAACGG + Intronic
938959125 2:136325090-136325112 CACCTGGAGTCACCTCCTCCAGG - Intergenic
943103993 2:183520446-183520468 AACCTGGACTTCCCTCATCATGG - Intergenic
945150399 2:206784575-206784597 GATCTGTATTTACCACCTTATGG + Intronic
945940655 2:215946129-215946151 AACCTGGATTTTCTTCCTCAGGG + Intronic
946700545 2:222408534-222408556 GACCTTGATTAACCTGCCCATGG + Intergenic
946964571 2:225024070-225024092 GACCTCAGTTTACATCCTCATGG - Intronic
947853389 2:233306630-233306652 GACCAGGAGTCACTTCCTCAGGG - Intergenic
1169402469 20:5294600-5294622 CACCTAGATTTAGCTCCTGAAGG + Intergenic
1172631871 20:36384017-36384039 GACCTGGAAGTAGCTTCTCAGGG + Intronic
1175320852 20:58087217-58087239 GACCAAGATCTACCTCCTCCAGG + Intergenic
1176271373 20:64236658-64236680 TTCCTGGATTTCCCTGCTCATGG + Intronic
1179182145 21:39054634-39054656 GACCATGATTTCACTCCTCAAGG + Intergenic
1179788764 21:43743702-43743724 GACCTGGATTCTCCCCCTAAAGG + Exonic
1180185490 21:46137176-46137198 GGCCTGGATTCACAGCCTCAGGG - Intronic
1183770310 22:39919319-39919341 GACCTGTATTTACCTTCTCTTGG - Intronic
950705338 3:14776026-14776048 GTCCTGGATGCACCTCCACAGGG - Intergenic
956894485 3:73645817-73645839 GACATAGAATTATCTCCTCATGG + Intergenic
958795124 3:98698951-98698973 GAACAGAATTTACCTCTTCATGG - Intergenic
959557101 3:107733213-107733235 CACCTGTGTTTACATCCTCATGG - Intronic
961212495 3:125136515-125136537 GACCTGGATTTCATGCCTCAAGG - Intronic
962281336 3:134054105-134054127 AACATGGCTTTACCTCCCCAGGG - Intergenic
962597063 3:136956967-136956989 GTCCTGGAGTCACCTCCTCCAGG + Intronic
964315932 3:155444288-155444310 TAGCTAGATTAACCTCCTCATGG + Intronic
973276975 4:48320226-48320248 CACCTTGCTTTACCACCTCAGGG + Intergenic
981833893 4:149032108-149032130 GAACAGGTTTTCCCTCCTCAAGG + Intergenic
982203348 4:152978913-152978935 GCCCTGGAAATACCTACTCAGGG - Exonic
983293853 4:165840468-165840490 CACCAAGATTTACTTCCTCAAGG + Intergenic
983707076 4:170675162-170675184 GCCCTGGATTTACCTCAACATGG - Intergenic
984241029 4:177219461-177219483 GAGCTTGATTTACATCCTGAGGG + Intergenic
985123225 4:186664619-186664641 AGCCAGGATTTACCTCCTCTGGG + Intronic
998155153 5:139781991-139782013 TGCCTGGATTTACCTGCCCAGGG + Intergenic
998783350 5:145682667-145682689 TACCAGCATTTCCCTCCTCATGG - Intronic
1002795080 6:465541-465563 GCCCTTGATTTTCCTCCTCCAGG - Intergenic
1005753375 6:28904053-28904075 GGCCTGAATTCACCTCCTCAAGG + Exonic
1006299208 6:33184979-33185001 GGCATAGAGTTACCTCCTCAAGG + Exonic
1010602255 6:77844026-77844048 GACTTTGATTTAACTCCTTAGGG - Intronic
1013079644 6:106801179-106801201 GGCCTGGAATTCCCGCCTCAAGG + Intergenic
1013411602 6:109888563-109888585 GGCCTGCATTTGCCTTCTCAAGG + Intergenic
1014048111 6:116917641-116917663 AACCTGGTTTCTCCTCCTCATGG + Intronic
1014855741 6:126398411-126398433 GTCCTGGAACTAACTCCTCATGG - Intergenic
1015542734 6:134332331-134332353 GAACTGGTTTCTCCTCCTCAGGG - Intergenic
1017373399 6:153738644-153738666 CAACTGGATTTACCTCTTGAAGG - Intergenic
1017683235 6:156885080-156885102 AACCTGGCTTTACCTTCTAATGG + Intronic
1019995050 7:4718582-4718604 GACCTAGGTTTCCCTCGTCAGGG + Intronic
1020366459 7:7385905-7385927 GACATGGATTTACTTGCTAAAGG - Intronic
1020398464 7:7745919-7745941 GACCGAGACTTACCTTCTCATGG + Intronic
1022640514 7:32178123-32178145 GGCCTGGCTTCACCTCCTCTTGG - Intronic
1023753310 7:43392389-43392411 GACCTGGGTTTACTTCCTTTGGG - Intronic
1039757730 8:40541295-40541317 GCCCTGGTTTTACCTGTTCAAGG + Intronic
1041696754 8:60744117-60744139 GACCTGGGTTCACCTCCCCGGGG - Intronic
1042007605 8:64199138-64199160 TACCTGGGTTTACCTCCTTCTGG + Intergenic
1042214517 8:66416703-66416725 GATTTGGATTTAACTGCTCATGG + Intergenic
1042415637 8:68514493-68514515 GACTTGGATTTCCCTTCTGATGG + Intronic
1046184525 8:110695251-110695273 GCACTGTATTTACATCCTCATGG + Intergenic
1046572891 8:115988911-115988933 GACCTAGATTTACCACCAAATGG + Intergenic
1047904053 8:129453906-129453928 GATCTGGAGTTACCTCCTCTGGG + Intergenic
1048156546 8:131960687-131960709 GACCAGGATTTATATCCTTAAGG + Intronic
1048307502 8:133294589-133294611 GGCCTGAACTTGCCTCCTCATGG - Intronic
1050331374 9:4549652-4549674 GACCTGGAGTGACCTCTTCCTGG + Intronic
1051818815 9:21141124-21141146 TCCCTGGAAGTACCTCCTCAAGG + Exonic
1051822972 9:21190800-21190822 TCCCTGGAAGTACCTCCTCAAGG + Intergenic
1051824796 9:21209335-21209357 TCCCTGGAAGTACCTCCTCAAGG + Intronic
1051826795 9:21231412-21231434 TCCCTGGAAGTACCTCCTCAAGG + Intronic
1051846410 9:21455911-21455933 TTCCTGGAAATACCTCCTCAAGG - Intergenic
1053018664 9:34679074-34679096 AATCTGGATGTACCTTCTCAGGG + Intergenic
1054792148 9:69266272-69266294 GATCTGGCTTCAGCTCCTCACGG + Intergenic
1055751864 9:79515224-79515246 GACCAGAACTTTCCTCCTCATGG - Intergenic
1056925849 9:90834020-90834042 GTTCTAGATTTAACTCCTCATGG + Intronic
1061291457 9:129652644-129652666 CACCTGGCTTTACCTGCTCCCGG - Intergenic
1062256134 9:135622350-135622372 GACCTGGGGCTACCACCTCAGGG - Intergenic
1187736764 X:22312682-22312704 AAGCTGAATTAACCTCCTCAAGG - Intergenic
1190900864 X:54671994-54672016 CACCCTGATTCACCTCCTCATGG - Intergenic
1198425382 X:136514276-136514298 GAACTGGACTTGGCTCCTCAGGG - Intergenic