ID: 900439369

View in Genome Browser
Species Human (GRCh38)
Location 1:2645705-2645727
Sequence ACAGAGAAGCAGGAAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1197
Summary {0: 1, 1: 1, 2: 15, 3: 131, 4: 1049}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900439369_900439382 24 Left 900439369 1:2645705-2645727 CCTGCCCCTTCCTGCTTCTCTGT 0: 1
1: 1
2: 15
3: 131
4: 1049
Right 900439382 1:2645752-2645774 CTGATTCTGGTTAGCATTTGAGG 0: 1
1: 0
2: 1
3: 16
4: 168
900439369_900439377 11 Left 900439369 1:2645705-2645727 CCTGCCCCTTCCTGCTTCTCTGT 0: 1
1: 1
2: 15
3: 131
4: 1049
Right 900439377 1:2645739-2645761 CCTACCATCCCTCCTGATTCTGG 0: 1
1: 0
2: 2
3: 9
4: 141
900439369_900439383 25 Left 900439369 1:2645705-2645727 CCTGCCCCTTCCTGCTTCTCTGT 0: 1
1: 1
2: 15
3: 131
4: 1049
Right 900439383 1:2645753-2645775 TGATTCTGGTTAGCATTTGAGGG 0: 1
1: 0
2: 2
3: 16
4: 183
900439369_900439384 26 Left 900439369 1:2645705-2645727 CCTGCCCCTTCCTGCTTCTCTGT 0: 1
1: 1
2: 15
3: 131
4: 1049
Right 900439384 1:2645754-2645776 GATTCTGGTTAGCATTTGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900439369 Original CRISPR ACAGAGAAGCAGGAAGGGGC AGG (reversed) Intronic
900394090 1:2446093-2446115 ACAGGGAAGCAGGACGGGGGTGG - Intronic
900424722 1:2571228-2571250 TCAGAGAAACAGAAAGAGGCAGG + Intergenic
900439369 1:2645705-2645727 ACAGAGAAGCAGGAAGGGGCAGG - Intronic
900528194 1:3139468-3139490 ACAGAGCTGCTGGCAGGGGCGGG + Intronic
900694129 1:3999721-3999743 TCACAGAGGGAGGAAGGGGCCGG + Intergenic
900699007 1:4032410-4032432 ACACGGAAGCAGGAAAGGGATGG - Intergenic
900735987 1:4299870-4299892 AGAGGGAAGGAGGAAGGGACAGG - Intergenic
900758061 1:4451241-4451263 ACTGGGAAGGAGGAAGGGGCTGG - Intergenic
901028356 1:6291396-6291418 TCCCAGAAGCTGGAAGGGGCAGG + Intronic
901089075 1:6629549-6629571 ACTGAGGGGCAGGAAGGGGTCGG - Intronic
901413372 1:9100553-9100575 ACAAAGAGGCAGAAAGCGGCTGG + Exonic
901420291 1:9146179-9146201 ACAGAGGAAGAGGAAGGGGCTGG + Intergenic
902682341 1:18052191-18052213 ACAAAGAAGAAGAAAGGGGGGGG - Intergenic
902817459 1:18924446-18924468 AGAGGGCAGCAGGAAGGGACAGG + Intronic
902830195 1:19007604-19007626 ACAGATAAGCAGGTGGGGTCAGG + Intergenic
903342857 1:22665373-22665395 GCAAAGAAGCAGGAAGGTGGGGG + Intergenic
903346153 1:22685564-22685586 ACAGGGAAGGAGGAATGGGCTGG - Intergenic
903476276 1:23621030-23621052 ACAGAGAAACCAGAAGAGGCAGG - Intronic
903502207 1:23807087-23807109 ACAGAGAAGCACAGAGGAGCAGG + Intronic
903574545 1:24330791-24330813 ACACAGAGGCAGGAAGGACCCGG - Intronic
904201903 1:28825338-28825360 AGAGAGAGGCAGGGAGTGGCTGG + Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904333972 1:29785122-29785144 ACAGAGAGAGAGGGAGGGGCAGG + Intergenic
904347500 1:29882847-29882869 ACCCAGAAGCTGGAAGGGGTGGG - Intergenic
904475778 1:30763857-30763879 ACAGAGCAGCCCGAAGGGCCAGG + Intergenic
904584416 1:31572008-31572030 ACAGAGGAGCAGGAAGGGGCTGG - Intergenic
904594142 1:31632488-31632510 ACAGAGCTGCAGCAAGGTGCGGG - Exonic
904696423 1:32334316-32334338 ACAGGGAAGGAGGTAGGGCCAGG + Exonic
904738046 1:32650351-32650373 AAAGAGCAGCAGGAAGCCGCGGG + Intronic
904917303 1:33979440-33979462 CCACAGTAGGAGGAAGGGGCAGG - Intronic
905309939 1:37042385-37042407 ACAGAGATGCAGGGAGAAGCGGG - Intergenic
905696863 1:39980897-39980919 TCAGAGAAATAGGAAAGGGCAGG + Intergenic
905872900 1:41415251-41415273 AGGGAGAAGCAGGAAGGTGGAGG - Intergenic
905892478 1:41526046-41526068 ACAGAGGGGCAGGAGGTGGCTGG + Intronic
906077581 1:43063342-43063364 ACCGAGACTCAGAAAGGGGCAGG + Intergenic
906294094 1:44638385-44638407 AGAGAGAAGGAGGCAGAGGCAGG + Intronic
906514663 1:46431852-46431874 GAAGAGCAGCATGAAGGGGCAGG + Intergenic
906515796 1:46438200-46438222 ACAGAGAACCAGGCAGGGTCGGG + Intergenic
906656558 1:47552474-47552496 AGAGAGAAGCAGTATGGGTCAGG + Intergenic
906832122 1:49044199-49044221 AGAGGGAAGTAGGAAGAGGCAGG + Intronic
906994625 1:50778668-50778690 GAAGAGAAGGAGGAAGGGGAGGG + Intronic
907288086 1:53395020-53395042 AGGGAGAAGCGGGCAGGGGCTGG - Intergenic
907306092 1:53513888-53513910 GCAGGGAAGGAGGAAGGTGCTGG + Intronic
907384694 1:54118424-54118446 ACAGAGTGGGAGGCAGGGGCTGG - Intergenic
907419238 1:54335766-54335788 TCAGAGAAACAGCAAGGGGCTGG + Intronic
907460865 1:54604681-54604703 ACAGAGAGGGAGGAAGTGCCTGG - Intronic
907629619 1:56067158-56067180 GCTAAGAAGCAGGAAGGGGCAGG - Intergenic
907632385 1:56095670-56095692 GAAAAGAAGCAGGATGGGGCAGG - Intergenic
907916201 1:58872228-58872250 ACAGAGAAACAAGGAGGGGATGG - Intergenic
909013288 1:70357352-70357374 ACAGAGAACTAGGTATGGGCTGG + Intronic
910244376 1:85122946-85122968 CCAGAGAAGCAGGAAGACCCTGG + Intronic
910432670 1:87174476-87174498 ACACAGAAGCAGGAAAAGCCAGG + Intergenic
910668992 1:89754126-89754148 ACAGAGAAGGAGAATGGGACAGG - Intronic
910712148 1:90193223-90193245 ACAGAGAAGGAAAAAGGGACAGG + Intergenic
911031737 1:93496237-93496259 AAAGAGGAGAAGGAAGGGGGAGG - Intronic
911095296 1:94049943-94049965 CCAGAGAGGAAGGCAGGGGCAGG + Intronic
911315877 1:96356152-96356174 ACAATGAAGCAGGAAGAGGTGGG - Intergenic
912492550 1:110070248-110070270 AGAGATAAGCAGGAAGGCCCGGG + Intronic
912572860 1:110637402-110637424 GCAGCAGAGCAGGAAGGGGCAGG - Intergenic
912614449 1:111084121-111084143 AGAGAGAAGCATGAAGGGGGAGG - Intergenic
912724777 1:112049281-112049303 ACAGAGAAGCAGGTAGGGTGAGG - Intergenic
912730324 1:112096597-112096619 ACTGAGAGGCAGGAAGTGGGCGG + Intergenic
912812210 1:112803011-112803033 ACAAAGAAGCAGGCAGGGGCAGG - Intergenic
914258178 1:145977370-145977392 AAGGAGAGGAAGGAAGGGGCTGG - Intronic
914323944 1:146592667-146592689 TCAGAGAAGCAGAAAGGTGTGGG + Intergenic
914324055 1:146593922-146593944 TCAGAGAAGCAGAAAGGTGTGGG - Intergenic
914513286 1:148352971-148352993 GCAGAGAAGGAGGAGGAGGCAGG + Intergenic
914689141 1:150010385-150010407 TCTGAGAAGCCGGGAGGGGCGGG + Intronic
915183049 1:154080061-154080083 ACACAGAAGAAGGAAGAGGCTGG + Intronic
915310079 1:155002250-155002272 GCAGAGCAGCAGCAAAGGGCTGG + Intergenic
915367660 1:155324614-155324636 ACAGGGAACCGGGATGGGGCTGG + Intronic
915399680 1:155613093-155613115 TCAGGGAATCAGGAAGGGACTGG - Exonic
915416791 1:155748649-155748671 TCAGGGAATCAGGAAGGGACTGG - Intergenic
915531545 1:156505113-156505135 AGAGAGAAGGAGGGAGGAGCTGG - Intergenic
915535223 1:156531267-156531289 ACAGAGGAGAGGTAAGGGGCAGG + Intronic
915859972 1:159433660-159433682 TGAGAGAAGCAGGATGGGGCAGG - Intergenic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
915973291 1:160368560-160368582 ACAGAGGTGGAGGAAGAGGCTGG + Intronic
916128127 1:161589331-161589353 ACAGGGAAGAAGGAGGGAGCAGG - Intronic
916138044 1:161671161-161671183 ACAGGGAAGAAGGAGGGAGCAGG - Intronic
916443231 1:164847771-164847793 ACAGAGAAGCAGTATGTGTCTGG + Exonic
916471174 1:165124268-165124290 ACAGGCAACCAGGAAGGGGCAGG + Intergenic
917779624 1:178379388-178379410 ACAGAGAGAAAGGAAGGGGAGGG + Intronic
918011432 1:180590561-180590583 ATAGAGAGGTAGGCAGGGGCTGG + Intergenic
918117754 1:181511277-181511299 ACAGACATCCAGGAAGGGCCAGG + Intronic
918437866 1:184534954-184534976 AAAGAGGAGCAGTGAGGGGCTGG + Intronic
919597161 1:199578547-199578569 ACACAGAAGGAGGTAGTGGCAGG + Intergenic
919914429 1:202130791-202130813 TAAGGGATGCAGGAAGGGGCCGG + Exonic
919918504 1:202153885-202153907 ACAGGGCAGCAGAGAGGGGCTGG + Intronic
919930938 1:202221263-202221285 AGAGAGCAGCTGAAAGGGGCTGG - Intronic
920045436 1:203129348-203129370 CCAGAGAAACAGGAGGGGGATGG + Intronic
920085081 1:203409410-203409432 ACAAGGAAACAGGCAGGGGCAGG + Intergenic
920177773 1:204113856-204113878 ATAGGGGAGCAGGTAGGGGCTGG - Intronic
920309118 1:205038272-205038294 ACATGGGAGCTGGAAGGGGCAGG - Intergenic
920499470 1:206477219-206477241 ACAGGGAAGTAGCAAGTGGCTGG + Intronic
920653128 1:207853376-207853398 CAAGAGAAGAGGGAAGGGGCTGG + Intergenic
920724753 1:208423670-208423692 ACAGGGAAAGAGGAAGGGGCGGG + Intergenic
920968445 1:210721618-210721640 TCAAAAAAGCAGCAAGGGGCTGG - Intronic
921385177 1:214561362-214561384 ACAGAAAAGCAGCATGGGCCGGG - Intergenic
921593514 1:217030225-217030247 ACAGAGAAGAGTGAAGGGACAGG - Intronic
921925693 1:220708396-220708418 TCTGAGAAGAAGGGAGGGGCTGG + Intergenic
922327156 1:224538630-224538652 AGAGAGAAGGAGGAGGAGGCAGG - Intronic
922351130 1:224735401-224735423 AAAGAGGAGCAGGAAGGAGGAGG - Intronic
922777109 1:228220055-228220077 AGAAAGAACCAGGAAGGTGCCGG + Intronic
923009029 1:230073729-230073751 ACAAAGAAGCAGTTAAGGGCTGG + Intronic
923493525 1:234505406-234505428 ACACAGACACAGGAGGGGGCAGG + Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923525742 1:234771324-234771346 ACAGAGACGCTGGAGGAGGCTGG + Intergenic
923705010 1:236336893-236336915 TCAGAAAGGCAGGAAGTGGCTGG + Intergenic
923797308 1:237170294-237170316 GCAGAGAAGCAGCAAGTGCCAGG + Intronic
923983398 1:239352381-239352403 ACAGAGAACCAGGAGAGGGAAGG - Intergenic
1063161688 10:3423215-3423237 GCAGAAAAGCAGGGAGGTGCCGG - Intergenic
1063381192 10:5587369-5587391 TCAGGGAAGCTGGAAGGGGGCGG - Intergenic
1063652236 10:7949184-7949206 ACAGAGAAAGAGGAAGGGGCTGG + Intronic
1063884884 10:10567479-10567501 GCAGAGAAGCAGAATGGGGCGGG + Intergenic
1064460333 10:15529002-15529024 ACAGGGAGGAAGGAAGGGGAAGG - Intronic
1065121992 10:22539180-22539202 ACACAGAGCCAGGAGGGGGCTGG + Intronic
1065527562 10:26638330-26638352 ACAGGGAAAGAGGAAGGGGTGGG - Intergenic
1065567576 10:27029863-27029885 ACACAGAAGCGGGAATGGCCGGG + Intronic
1066728904 10:38419092-38419114 AGAGAGAGGGAGGAAGGGGAAGG - Intergenic
1067056373 10:43054744-43054766 ACAGAGAACCAAGATGGGCCAGG - Intergenic
1067544860 10:47185264-47185286 AGAGAGGGGCAGGTAGGGGCAGG - Intergenic
1067555550 10:47267399-47267421 TCAGAGAGGGAGGAAGTGGCTGG + Intergenic
1067772822 10:49139499-49139521 TCAGGGAACCAGGAGGGGGCTGG + Intergenic
1067912832 10:50364419-50364441 AGTGAAAAGCAGGATGGGGCTGG - Intronic
1068497757 10:57806862-57806884 AGAGTGTAGGAGGAAGGGGCCGG - Intergenic
1068839288 10:61592129-61592151 AGAAGGAAGCAGGAAAGGGCAGG - Intergenic
1068846424 10:61680867-61680889 ACAGGGAAGAAAGAAGGGGAAGG + Intronic
1068891356 10:62151296-62151318 CCAGAGCAGGAGGAAGGGGATGG - Intergenic
1069513326 10:69058009-69058031 ACAGATAAGGAGGAAAGGGTGGG + Intergenic
1069674301 10:70236355-70236377 GCAAAGAAGTAGGAATGGGCCGG - Intergenic
1069920193 10:71811688-71811710 GGAGAGAAGCAGAGAGGGGCTGG - Intronic
1069932584 10:71892577-71892599 AGAGAGAAGCACGAAGCGCCGGG - Intergenic
1069935690 10:71914361-71914383 ACAAAGATGCACAAAGGGGCTGG - Intergenic
1070508865 10:77141267-77141289 ACAGAGAACTAAGAGGGGGCTGG - Intronic
1070679011 10:78435622-78435644 ACAGAGAGATGGGAAGGGGCCGG + Intergenic
1070804917 10:79265272-79265294 ACAGGGAAGCAGGTAGGGCAGGG + Intronic
1070845117 10:79515560-79515582 ACAGAAGATCAGGAAGGAGCAGG - Exonic
1070928683 10:80244749-80244771 ACAGAAGATCAGGAAGGAGCAGG + Intergenic
1070967095 10:80536360-80536382 AGGGAGCAGCAGGAATGGGCCGG - Intergenic
1071135847 10:82453395-82453417 ACAGATAAGAAGGAAGAGTCTGG + Intronic
1071353097 10:84766350-84766372 ACGGAGAAGCGGGAAAGAGCTGG + Intergenic
1071384306 10:85104225-85104247 ATGGAGCAGCAGGGAGGGGCTGG - Intergenic
1071536859 10:86440619-86440641 ACAGGAAAGGAGGAAGAGGCAGG - Intronic
1071718513 10:88120213-88120235 AAAGGGAAGCAGGAAGGCGGGGG + Intergenic
1071986659 10:91058468-91058490 AGACAGAAAAAGGAAGGGGCTGG - Intergenic
1072439275 10:95439403-95439425 CCAGAGAAGGAGGAAGGGAGGGG - Intronic
1072804662 10:98416939-98416961 CCAGCCAAGCATGAAGGGGCTGG + Exonic
1073030802 10:100524145-100524167 AGAGAGAAGGAGAAAGGGGGAGG + Intronic
1074456739 10:113602172-113602194 TCAGAAAAGCAAAAAGGGGCCGG - Intronic
1074532059 10:114304979-114305001 ACGCAGATGCAGGAGGGGGCGGG + Intronic
1074532071 10:114305015-114305037 ACACAGATGCAGGAGGGGGCGGG + Intronic
1074719459 10:116251864-116251886 GCAGAGGAGCAGAAATGGGCAGG + Intronic
1074724131 10:116289926-116289948 ACAGGGAAGCAGGAAGGGAGAGG - Intergenic
1074755479 10:116621243-116621265 ACAGTGAGGCTGGCAGGGGCAGG - Intronic
1074866577 10:117547461-117547483 ACAGGTGAGCAGGAAGGGGATGG - Intronic
1075058493 10:119237923-119237945 AGAGGGATGGAGGAAGGGGCTGG + Intronic
1075180436 10:120206153-120206175 AGAGAGACACGGGAAGGGGCAGG - Intergenic
1075201533 10:120408649-120408671 ACAGAGAACCAGGAAGCTGTTGG - Intergenic
1075223634 10:120605459-120605481 ACAGAGAGGCAGAGAGGTGCTGG - Intergenic
1075263834 10:120984277-120984299 ACAGAGCAGCAGAACGGGGTTGG - Intergenic
1075313918 10:121437081-121437103 AGAGAGAAGAAAGAGGGGGCTGG + Intergenic
1075452517 10:122561827-122561849 ACAGAGAAGGAGGAGGAGGGAGG - Intronic
1075688045 10:124377568-124377590 GCAAAGAAGCAGGACAGGGCTGG - Intergenic
1076444320 10:130501529-130501551 CCCCAGAAGCTGGAAGGGGCAGG - Intergenic
1076473852 10:130738846-130738868 ACAGAGCAGAAGCAATGGGCAGG - Intergenic
1076541381 10:131217250-131217272 AGAGAGAAGCAGGATAGGGGAGG - Intronic
1076858930 10:133130610-133130632 ACAGACAAGGAGGAAGAGGGAGG - Exonic
1077174403 11:1182079-1182101 ACAGAGCCGCAGGGAGGGGCGGG + Intronic
1077289574 11:1782656-1782678 ATTGGGTAGCAGGAAGGGGCAGG - Intergenic
1077476026 11:2790917-2790939 TAAGAGAAGCAGGAAGCCGCTGG - Intronic
1077516222 11:3003599-3003621 TCAGAGACTCAGGATGGGGCTGG + Intronic
1077600323 11:3570130-3570152 GCAGACAAGCGGGTAGGGGCTGG + Intergenic
1077618775 11:3700057-3700079 TTAGAAAAGCAAGAAGGGGCCGG + Intronic
1077671962 11:4165677-4165699 ACAGACCAGTAGGAAGGGCCTGG - Intergenic
1077874670 11:6294098-6294120 CAAGAGAAGGAGGCAGGGGCAGG + Intergenic
1078328245 11:10397834-10397856 GCCAAGAAGCAGGAAGGGGCTGG + Intronic
1078550839 11:12279665-12279687 AGAGAGAGGCAGGAAGGGAGAGG - Intronic
1079132125 11:17753204-17753226 GCAGAGAGGCAGCAAGGAGCAGG + Intronic
1079209788 11:18450565-18450587 ACAGTGAAGCAGGAGGTGACTGG - Intronic
1079311971 11:19374899-19374921 ACTGAGAATCAGGAAGGGGATGG - Intronic
1079328304 11:19513015-19513037 ACAGAGACCCAGGCTGGGGCAGG + Intronic
1079400635 11:20103770-20103792 GAAGAAAAGCAAGAAGGGGCGGG + Intronic
1079502143 11:21113170-21113192 ACATACAAGCAGAGAGGGGCTGG + Intronic
1080502828 11:32886651-32886673 ACAGTGATGCAGGCAGGGCCTGG - Intergenic
1080694982 11:34595643-34595665 ACACAGAAGAAGGAAGGATCAGG - Intergenic
1080886467 11:36372631-36372653 CAAGAGAAGCAGGGAGTGGCTGG + Intronic
1080896437 11:36452364-36452386 AGAGAGGCCCAGGAAGGGGCAGG - Intronic
1081167540 11:39824175-39824197 AAAGAGAAGAAGGAAGTGTCAGG + Intergenic
1081494815 11:43597929-43597951 AAAGAAAAGCAGGAGGGGGCTGG - Intronic
1082875341 11:57982193-57982215 AGAGAGGAGCAGGAGTGGGCAGG + Intergenic
1082899281 11:58228216-58228238 GCAGATGAGCAGGAAGGGGATGG + Exonic
1083270436 11:61569576-61569598 CCAGAGAGACAGGAAGGGGTAGG + Intronic
1083273798 11:61585841-61585863 ACAGAGAAACAGGCAGAGGTAGG - Intergenic
1083599751 11:63939340-63939362 TCCGCGAAGCAGGAAGGGGCGGG - Intronic
1083756766 11:64796218-64796240 GCAGAGGGGCAGGGAGGGGCTGG - Intronic
1083823718 11:65186716-65186738 ACAGAGGAGCAGGGAAGGGTGGG - Intronic
1083904350 11:65660403-65660425 ACAGGGAGGCTGGCAGGGGCAGG - Intronic
1084087681 11:66862034-66862056 ACAGAGCAACGGGCAGGGGCAGG + Intronic
1084121497 11:67071618-67071640 CCAGCGACGCGGGAAGGGGCAGG + Exonic
1084256237 11:67944751-67944773 GCAGACAAGCAGGTAGGGGCTGG + Intergenic
1084347669 11:68566307-68566329 AAAGAGAAGGAGGAAGGAGGAGG - Intronic
1084425752 11:69083840-69083862 ACAGAAAGGCAAGATGGGGCAGG - Intronic
1084465325 11:69319979-69320001 ACAGAGGGGCAGGAAGGCGGAGG + Intronic
1084556647 11:69879774-69879796 GCAGAGACCCAAGAAGGGGCCGG + Intergenic
1084561359 11:69907280-69907302 AGAGAGGAGGTGGAAGGGGCAGG + Intergenic
1084599656 11:70137356-70137378 CCAGGGAGGCAGGCAGGGGCAGG - Intronic
1084735775 11:71104362-71104384 TCAGAGATGCAGGATGGGGGGGG - Intronic
1084816524 11:71650552-71650574 GCAGACAAGCAGGTAGGGGCTGG - Intergenic
1085018256 11:73189343-73189365 ACAGAGGAGGAGAAAAGGGCCGG + Intergenic
1085259496 11:75196068-75196090 CCAGAGAGGCAGGAACAGGCTGG + Intronic
1085265078 11:75232649-75232671 ACAGAGATGCAGAAAGGAACAGG - Intergenic
1085304409 11:75476964-75476986 TCAGACAAGCAGGAAGGAGGAGG + Intronic
1085452320 11:76642072-76642094 AGCGAGGGGCAGGAAGGGGCAGG + Intergenic
1086181813 11:83960973-83960995 ACAGGAAAGGAGGCAGGGGCAGG + Intronic
1087433218 11:98080022-98080044 CCAGAGCAGGAGGAAGGAGCAGG - Intergenic
1087601978 11:100328551-100328573 CCAGAGAAGAAGGAAGAGACAGG + Intronic
1087654436 11:100905308-100905330 ACAGAGATGGAGCAAGGAGCTGG + Intronic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1088819867 11:113447943-113447965 ACTGACAAGCAGGGAGGGCCTGG - Intronic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089225991 11:116922489-116922511 AAAAAGAAGGGGGAAGGGGCGGG + Intronic
1089359074 11:117874556-117874578 CCAGGGAGGCAGGAAGGGGAGGG - Intronic
1089597612 11:119591130-119591152 ACAGAGAAGAAGGAAGAGAATGG + Intergenic
1089850104 11:121488285-121488307 AGAGAGAAGGAGGGAGAGGCAGG - Intronic
1090259284 11:125306980-125307002 ACAGAGAAGGAGAAACGGGGAGG - Intronic
1090477277 11:127034934-127034956 ACAGAGGTTCAGGAAAGGGCTGG + Intergenic
1090818629 11:130320188-130320210 AGAGAGAAGAAGGCAGTGGCTGG - Intergenic
1090834106 11:130441391-130441413 ACAGAGAAGCGGGAGGTGCCAGG + Intergenic
1090943501 11:131409527-131409549 GCAGAGAAGCTGAAAGGGCCAGG - Intronic
1091070612 11:132559149-132559171 AGAGAGAAGCAAGAAGGGGAGGG + Intronic
1091230108 11:133982673-133982695 ACAGAGCAGGAGCAAGTGGCAGG - Intergenic
1091363974 11:135001661-135001683 ACGGAGAAGCAGGAAGGAGAGGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091589188 12:1833414-1833436 ACACAGATGCAGGACAGGGCTGG - Intronic
1091628597 12:2141259-2141281 CCAGAGGAGCAGGAAGGATCTGG + Intronic
1091636285 12:2199334-2199356 ACTGAGGAGGAGGAAGGGGAGGG - Intronic
1091666451 12:2422230-2422252 AGAGAGGAGGAGGAAGGAGCGGG + Intronic
1091839688 12:3611945-3611967 ACAGGGAAGCAGGCAAGAGCCGG + Intronic
1091857209 12:3749548-3749570 ACAGGGAAGCAGGAAAGGAGAGG - Intronic
1091899600 12:4134330-4134352 AGAGAGAGGCTGGCAGGGGCTGG - Intergenic
1092426469 12:8379482-8379504 GCAGACAAGCAGGTAGGGGCTGG + Intergenic
1092653047 12:10655012-10655034 ACAGAGAGGGAGGAAAGGGAAGG - Intronic
1093096086 12:14973737-14973759 AGAAAGAGGCAGGAAGGAGCTGG - Intronic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1094292435 12:28867042-28867064 GCAGAGAAGCAGGGTGGGTCTGG - Intergenic
1095480361 12:42628722-42628744 ACACATAAGCAGGAATGGGCAGG - Intergenic
1095531130 12:43188104-43188126 ACAGAAAGGCAAGAAGGGGGAGG - Intergenic
1095709085 12:45269095-45269117 CCAGAGAAGAAGGGAGGGCCTGG - Intronic
1096419576 12:51445524-51445546 ACAGAAAAACAGGCAGGGGCAGG - Intronic
1096521051 12:52184895-52184917 ACCAGGAAGCAGGAAGGGGATGG - Intronic
1096525319 12:52206909-52206931 ACAGAGAGGGAGGTGGGGGCCGG + Intergenic
1096557644 12:52413250-52413272 AAAGATGAGCAGGCAGGGGCAGG - Intergenic
1096743211 12:53709571-53709593 ACAGTGAAGCAGAACAGGGCTGG + Intronic
1096814527 12:54193519-54193541 AGAGAGGAGCAGGAATAGGCTGG + Intergenic
1097156369 12:57015138-57015160 AAAGAGAAGAAGGAAGGGGTTGG + Intronic
1097178572 12:57157854-57157876 GCAGAGAAGGAGGCAGGGGTTGG + Intronic
1097260396 12:57716528-57716550 TCAGAGGAGCAGGATGGGGATGG + Intronic
1097391203 12:59016106-59016128 ACAGAGAGGCAGTAAGGGAGTGG - Intergenic
1097663607 12:62456296-62456318 AGAGAGAGACAGGAAGGGGTTGG - Intergenic
1097891439 12:64781085-64781107 ACAGAGGAGGAGGAGGCGGCGGG + Intergenic
1098077679 12:66750296-66750318 ACAGAGAAGCATGCTGGGGCAGG + Intronic
1098558956 12:71851173-71851195 ATAGAGCAGGAGGAAGGGGGAGG + Intronic
1099723597 12:86396643-86396665 GCAGAAAAGCAGGAAGTGGCAGG + Intronic
1101387170 12:104268150-104268172 AGAGAGAAAGAGGAAGGGGCCGG - Intronic
1101408750 12:104452417-104452439 ACTGAGGAGCAGCAAGAGGCAGG + Intergenic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101904232 12:108813272-108813294 ACAGAGAAGCCAGATGGGTCTGG + Intronic
1101907131 12:108835512-108835534 GCCGGGAAGCAGGAAGGGGAAGG + Intronic
1101918401 12:108913499-108913521 ACAGATAATAAGGATGGGGCTGG + Intronic
1101976125 12:109360425-109360447 ACAGAGAAGAGAGATGGGGCAGG - Intronic
1102548615 12:113674718-113674740 ACAGAGAAGGAGGGAGAGACAGG - Intergenic
1102595916 12:113992556-113992578 AGACAGAGGCAGGCAGGGGCAGG - Intergenic
1102813187 12:115841699-115841721 AGAGAGAAGGGGGAAGGGGAAGG - Intergenic
1103022988 12:117551309-117551331 AAAGAGGAGAAGGAAGAGGCAGG - Intronic
1103060497 12:117854718-117854740 AAAGAGAAGCAGGAAGCCTCAGG + Intronic
1103290615 12:119843197-119843219 AGAGAGAAACAGTAAGTGGCTGG + Intronic
1103727083 12:123003332-123003354 ACAGCAAAGCAGGAAGTGCCAGG - Intronic
1103795272 12:123499109-123499131 ACAGAGAGGCATGAAGTGGTGGG + Intronic
1103841599 12:123869700-123869722 CCTGAGAAGGAGGAAGGGGCTGG - Intronic
1103940725 12:124499916-124499938 ACAGAGAAGGGGAAATGGGCAGG + Intronic
1103991987 12:124805453-124805475 TCAGAGAGGCCGGTAGGGGCTGG + Intronic
1104148143 12:126055315-126055337 ACAGAAATGCAGAATGGGGCAGG - Intergenic
1104187693 12:126448526-126448548 ACAGAGAAGGAGGAAGAGACTGG + Intergenic
1104658438 12:130591598-130591620 CCCCAGAAGCTGGAAGGGGCTGG - Intronic
1104930170 12:132334647-132334669 ACAGAAAAGCAGGAGGGGAGGGG - Intergenic
1104991518 12:132626353-132626375 ACAGAGCAGCAGGGAGGCCCCGG - Intronic
1105815962 13:24036635-24036657 TTAGACAAGCAGGAAGGAGCAGG - Intronic
1106621129 13:31372135-31372157 ACAGAGAGGGAGGAAGAGACAGG + Intergenic
1107248303 13:38324528-38324550 ACAGAAAAGCTAGAAGGAGCTGG - Intergenic
1107879702 13:44822299-44822321 AAAGAGGAGGAGGAGGGGGCGGG - Intergenic
1108316770 13:49244173-49244195 GCAGAGGAAGAGGAAGGGGCTGG + Intergenic
1109600918 13:64627456-64627478 TCAGAGAAGGAGCAAGGGGTGGG - Intergenic
1112108447 13:96267791-96267813 ACAGGGAAGTAGGCAGGGGAAGG + Intronic
1112356551 13:98678667-98678689 ACAGGGCAGCAAGAAGGGGCAGG - Intergenic
1112630700 13:101158452-101158474 GCAGAGAAGGAGAAAGGGGTGGG + Intronic
1112761030 13:102693418-102693440 GCAGGGAAGCCGGCAGGGGCTGG - Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113608130 13:111624808-111624830 ACCTGGATGCAGGAAGGGGCAGG + Intronic
1113613660 13:111665624-111665646 GCAGACATGCGGGAAGGGGCTGG + Intronic
1113651858 13:112039183-112039205 GCAGAGAAGCAAGAGAGGGCTGG - Intergenic
1113983488 13:114295583-114295605 TCAGAGACGCAGGAAGAGGAGGG - Intronic
1114127288 14:19743704-19743726 ACAGAGGAGCAGGAAGGGGAGGG - Intronic
1114260780 14:21034628-21034650 GCAGAGAAGAAAGAAGGAGCAGG + Intronic
1114325801 14:21587688-21587710 ACATAGAAGCAAGCTGGGGCCGG + Intergenic
1114604950 14:23988880-23988902 ACAGAGTAGGGCGAAGGGGCAGG - Exonic
1114610399 14:24036434-24036456 ACAGAGTAGGGCGAAGGGGCAGG - Intergenic
1114616481 14:24071444-24071466 AGGGAGAAGAGGGAAGGGGCAGG - Intronic
1115058996 14:29168286-29168308 TCAGTGGAGCAGGTAGGGGCCGG + Intergenic
1115084160 14:29493214-29493236 AAAGAGAAGAGGGAAGGGGGAGG + Intergenic
1115658298 14:35465254-35465276 CCAAAGAAGCAGGAAGGAGGTGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117804481 14:59476814-59476836 ACAAAGAAGCAGGCACTGGCAGG + Intronic
1117962631 14:61178291-61178313 AAAGAAAGACAGGAAGGGGCGGG - Intergenic
1118669547 14:68108602-68108624 AGAGAGAGGCAGGAATGGGAAGG + Intronic
1118902837 14:70001073-70001095 ACAGAGCACCAGGAAGGGGCTGG - Intronic
1119418927 14:74494387-74494409 ACAGGCAAGGAGGAAGGGGTGGG + Exonic
1121009200 14:90510007-90510029 GCAGAGAGGCAGGGCGGGGCTGG + Intergenic
1121532871 14:94670923-94670945 AAAGAGAACCATGAAGGGGAAGG + Intergenic
1121586230 14:95064810-95064832 AGAGAGAAGAAGGGAGGGGAGGG + Intergenic
1121729719 14:96178061-96178083 ACAGAGAAACAGGCAGGGGAGGG + Intergenic
1121773816 14:96576985-96577007 GCAGAGGAACAGGAAGGTGCTGG + Intergenic
1122291447 14:100682405-100682427 ACAGAGGGGCTGGCAGGGGCGGG + Intergenic
1122370747 14:101227714-101227736 AGGGAGAAGCAGGTCGGGGCAGG + Intergenic
1122381856 14:101313555-101313577 AGGGAGAAGCAGGTCGGGGCAGG - Intergenic
1122453614 14:101832688-101832710 ACAGAGGAGCAGGGTGGAGCGGG + Intronic
1122634900 14:103125231-103125253 AGGGGGAAGCAGGCAGGGGCTGG - Intronic
1122832054 14:104403182-104403204 CCAGAGAAGGAGGAAGGGTGGGG - Intergenic
1122971680 14:105154799-105154821 ACAGAGGAGCAGGCGGGGCCGGG - Intronic
1123033688 14:105463142-105463164 TCACACAAGCAGGAAGGGGCAGG - Intronic
1123388162 15:19840380-19840402 ACAGAGACGCAGGGAGGAGATGG + Intergenic
1123570744 15:21605343-21605365 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123606857 15:22040696-22040718 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123708153 15:22965764-22965786 CCAGGGCAGCGGGAAGGGGCTGG - Intronic
1124492345 15:30165758-30165780 CCAGAGCAGGAGGAAGAGGCAGG - Intergenic
1124654742 15:31499126-31499148 ACAGAGGAGGAGGAAGTGGGTGG + Intronic
1124751191 15:32372559-32372581 CCAGAGCAGGAGGAAGAGGCAGG + Intergenic
1125506847 15:40272193-40272215 ACAAAGCAACAGGAAGGGTCAGG - Intronic
1125774783 15:42202666-42202688 AAAGAAAAGCAGGAACTGGCAGG - Intronic
1126098329 15:45104700-45104722 GTAGACAGGCAGGAAGGGGCTGG + Intronic
1126773076 15:52076943-52076965 ACACGAAAGCAGGGAGGGGCAGG - Intergenic
1126860424 15:52877573-52877595 AGAGAGATGGAGGAAGGGGAGGG - Intergenic
1127535447 15:59885829-59885851 ACAAGGGAGCAGGAAGGAGCAGG + Intergenic
1128215756 15:65933092-65933114 AGACAGAAGCAGAAAAGGGCTGG - Intronic
1128380333 15:67107572-67107594 TCAGAGAGGCGGGAAGGGCCGGG - Intronic
1128474049 15:67981951-67981973 ACTGGGAATCAGGAAGGTGCCGG + Intergenic
1128617866 15:69124249-69124271 TCAGAGGAGCAGGCAGGGGCTGG + Intergenic
1128687402 15:69696951-69696973 ACAGAGAAGCAGAATAGTGCTGG - Intergenic
1128796395 15:70469756-70469778 ACAGCGAAGCTGGCAAGGGCTGG + Intergenic
1129819442 15:78587568-78587590 TCAGATAAGCAAGAAGAGGCTGG + Intronic
1129887002 15:79045553-79045575 AGAGAGAAGCAGGCAGGAGGAGG - Intronic
1129944656 15:79528202-79528224 CCAGATAAGCAGGAAGGGAGAGG + Intergenic
1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG + Intronic
1130391812 15:83463066-83463088 TCAGGGAAGCATGAAGGGGAAGG + Intronic
1130513732 15:84609797-84609819 ACAATCAGGCAGGAAGGGGCTGG + Intronic
1130662272 15:85840167-85840189 ACGAAGAAGCTGGAAGGAGCAGG + Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1132056293 15:98651860-98651882 TCAGAGATGGAGGGAGGGGCAGG - Intronic
1132212708 15:100036212-100036234 GCAGAGAGGCAGCAAGGGGAAGG + Intronic
1132299547 15:100767520-100767542 ACAGAGAAGGAGGAAAGAGAAGG + Intergenic
1132333441 15:101027925-101027947 AGAGGGAAGAAGGAAGGGGAGGG - Intronic
1202979097 15_KI270727v1_random:332466-332488 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1132733486 16:1374549-1374571 ACCGAGCACCAGGCAGGGGCTGG - Intronic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1133026770 16:2992024-2992046 ACAGGGACACAGGAAAGGGCAGG - Intergenic
1133131822 16:3680807-3680829 ATACAGAAGGTGGAAGGGGCAGG - Intronic
1133214553 16:4283682-4283704 ACAGAGAGGGAGGCAGTGGCGGG - Intergenic
1133389776 16:5400387-5400409 AGAGAGAAGCAAGCAGTGGCCGG - Intergenic
1133577064 16:7102115-7102137 ACAGAGAAGTAGGCACAGGCAGG - Intronic
1133862622 16:9610428-9610450 TCAGAGAGGCAGGAAGGGAGTGG + Intergenic
1134038684 16:11051450-11051472 ACTTGGAAGGAGGAAGGGGCCGG - Intronic
1134054800 16:11163212-11163234 TCAGAGAATCAGGAGGGTGCTGG - Intronic
1135668483 16:24355219-24355241 AGAGGGAAGAAGAAAGGGGCAGG + Intronic
1135713249 16:24736525-24736547 AGAGAGAAGCAGAAAAGGGCAGG - Intronic
1135948866 16:26893153-26893175 AATGACAAGCAGGAGGGGGCTGG - Intergenic
1135973296 16:27087937-27087959 ACAGAGAAGCAGGGAGGTCAGGG - Intergenic
1135986050 16:27185129-27185151 CCAGAGCAGGAGGAAGCGGCAGG + Intergenic
1136419566 16:30123263-30123285 ACAGGCAGGCGGGAAGGGGCGGG - Exonic
1136608621 16:31352978-31353000 ACAGAGAGGCAGGAGGAGGCTGG - Intergenic
1136779626 16:32888089-32888111 ACAGAGAGCCAGGAATGAGCTGG - Intergenic
1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG + Intergenic
1137272695 16:46912739-46912761 AGAGAGAATCAGGGCGGGGCAGG + Intronic
1137434966 16:48447550-48447572 ACAGAGAAAGAGGAATGAGCTGG + Intronic
1137608226 16:49801181-49801203 ACAGAGAGGCAGGCTGTGGCAGG - Intronic
1137642707 16:50046732-50046754 ACAAAGCAAAAGGAAGGGGCCGG + Intergenic
1137670557 16:50275910-50275932 GCAGAGAACCATGAATGGGCTGG - Intronic
1137684071 16:50373788-50373810 GGAGAGAAGCAGGACGGGGTGGG + Intergenic
1138031333 16:53561852-53561874 GGAGAGAAGCAGGAAGAGCCTGG - Intergenic
1138087151 16:54143538-54143560 AAAGAGAAGAAGGAAGAAGCAGG + Intergenic
1138235007 16:55374693-55374715 ACACAGAGGGAGGAAGGGACTGG + Intergenic
1138499771 16:57433163-57433185 ACAGAGAACCAGGAAGTGTGAGG - Intronic
1138835414 16:60428876-60428898 AAAGAGAAGGAGGATGGGGTGGG + Intergenic
1139277088 16:65738011-65738033 ACAGGGAGGCAGGCAGGGGCTGG - Intergenic
1139340199 16:66263444-66263466 ACAGTTCAGCATGAAGGGGCAGG + Intergenic
1139956795 16:70697082-70697104 TCTGAGGGGCAGGAAGGGGCCGG - Intronic
1140009507 16:71116921-71116943 TCAGAGAAGCAGAAAGGTGTGGG + Intronic
1140009618 16:71118177-71118199 TCAGAGAAGCAGAAAGGTGTGGG - Intronic
1140230276 16:73112214-73112236 ACAGAGAAGAAGAGAGGGGTGGG + Intergenic
1140236805 16:73166527-73166549 AGAGAGAAGCAAGGAAGGGCCGG + Intergenic
1140282970 16:73572496-73572518 ACAGAAAGGCAGGAAGGAGAAGG + Intergenic
1140339320 16:74141467-74141489 AAAGAAAAGAAGGAAAGGGCCGG + Intergenic
1140546709 16:75816772-75816794 AGAGAGAAGCAGGAAAGTGCAGG + Intergenic
1140728920 16:77838656-77838678 ACAGAGAGGCAGGGAGGGAAAGG - Intronic
1140904069 16:79395530-79395552 ACAGAGAGGCACTGAGGGGCAGG + Intergenic
1141045448 16:80712534-80712556 ACCCAGCAGCAGGATGGGGCAGG + Intronic
1141131617 16:81441454-81441476 ACGGAGTAGCAGGAAGGGCACGG - Intergenic
1141165503 16:81658060-81658082 GCAGAGACGCAGGAAGGAGGAGG - Intronic
1141326768 16:83067812-83067834 AGAGAGAAGAAGAGAGGGGCAGG - Intronic
1141382886 16:83591606-83591628 TCAGAGAAGGAAGAAGGGCCTGG - Intronic
1141708068 16:85680332-85680354 GCAGAGCAGCAGGAAGGGCTGGG - Intronic
1141810372 16:86371824-86371846 AGAGAGGAGCAGTAGGGGGCAGG - Intergenic
1141942488 16:87286897-87286919 AAACACAAGGAGGAAGGGGCAGG + Intronic
1142126500 16:88413236-88413258 GCAGAGCAGCAGGAAATGGCTGG + Intergenic
1142129721 16:88427154-88427176 ACCTAGAAGCAGGAAGGGAGAGG - Intergenic
1142243857 16:88959492-88959514 ACAGAGGTGCAGGCAGAGGCAGG + Intronic
1142523065 17:518605-518627 AAAGAAATGGAGGAAGGGGCTGG + Exonic
1142555995 17:777867-777889 ACATAGACTCAGGATGGGGCTGG + Intronic
1142694026 17:1623584-1623606 GGAGAGAAGTGGGAAGGGGCGGG - Intronic
1142966562 17:3585547-3585569 ACTGAGAAGCGGGAAGGGGGCGG + Intronic
1143259312 17:5586238-5586260 TTAGTGAAGCAGGGAGGGGCAGG - Intronic
1143465127 17:7131390-7131412 CCAGAGAGGGAGGCAGGGGCTGG + Intergenic
1143716388 17:8773700-8773722 ACAAAGAAGCAGGGAGGGAACGG - Intergenic
1143770454 17:9165216-9165238 CCAGAGAGGCAAGAAGGGGCAGG + Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144952336 17:19000957-19000979 ACAGAGTGACAGGCAGGGGCTGG - Intronic
1145285452 17:21502935-21502957 AGAGTGAGGCAGGAAGGGTCAGG - Intergenic
1145904576 17:28509190-28509212 ACAGAGAGGGAGGGAGGGGCAGG - Intronic
1146178137 17:30679669-30679691 ACAGAGGAGCAGGAAGGAGGGGG + Intergenic
1146266834 17:31458419-31458441 CAAAAGCAGCAGGAAGGGGCTGG - Intronic
1146357048 17:32142885-32142907 AAAGAGAAGAGTGAAGGGGCTGG - Intronic
1146456961 17:33016043-33016065 CAAGAAAAGCAGGAAGGGGTTGG + Intronic
1146487824 17:33258409-33258431 ACAGAGAAGGAGGATGGGTAGGG + Intronic
1146557933 17:33842624-33842646 ACAGAGAATTAGGAAGGAGGAGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1147055409 17:37830551-37830573 AAAGAGTAGCAGGCAGGGGCAGG + Intergenic
1147302605 17:39541764-39541786 AGAGAGAAGCTGTAAAGGGCAGG + Intronic
1147303204 17:39546089-39546111 ATAAAAAAGGAGGAAGGGGCCGG - Intronic
1147421462 17:40324011-40324033 ACAGAGATACAGGCAGGGCCAGG - Intronic
1147606410 17:41776144-41776166 ACAGAGGAGCAGGGCGGAGCAGG + Intronic
1148093842 17:45039041-45039063 ACAGGTAAGCAGGAATGGTCAGG + Intronic
1148152497 17:45404913-45404935 ACTCAGGAGCAGGTAGGGGCAGG - Exonic
1148735301 17:49861698-49861720 CAAGTGAGGCAGGAAGGGGCTGG + Intergenic
1148768413 17:50052891-50052913 ACAGAGAAGAGGGAAGGGTGAGG + Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1148896590 17:50842584-50842606 ACACAAAGGCAGGAAGGGGTGGG + Intergenic
1149367507 17:55960587-55960609 AGACAGAAGCAGGAGGGGGCAGG + Intergenic
1149485801 17:57041969-57041991 ACTGAGACACAGGAAGGGTCTGG + Intergenic
1149852224 17:60044790-60044812 ACAGAGAAGCCAGGAAGGGCTGG - Intronic
1149867287 17:60157864-60157886 CCAGCGAGGCAGGAGGGGGCGGG + Intronic
1150287094 17:63960666-63960688 ATAGTGGAGCAGGAAAGGGCTGG + Intronic
1150645509 17:66975266-66975288 CCAGGGACACAGGAAGGGGCTGG + Intronic
1150819952 17:68426999-68427021 ACAGTGAAGGGGGAAGGGGAGGG + Intronic
1150819969 17:68427043-68427065 ACAGTGAAGGGGGAAGGGGAGGG + Intronic
1151414853 17:73955450-73955472 ACAGAAAAGAAGGAAGGGACGGG + Intergenic
1151419837 17:73989967-73989989 ACGGACAAGAAGGAAGGCGCTGG - Intergenic
1151527287 17:74679406-74679428 CCAGAGAAGGAGGAAGGATCTGG - Intronic
1151553910 17:74837089-74837111 ACAAGGACGCAGGATGGGGCAGG - Exonic
1151759229 17:76091099-76091121 ACAGTGGAGGAGGAAGGGACAGG + Intronic
1151806261 17:76407465-76407487 CCAGAGAAGCCAGAAGCGGCAGG + Intronic
1152008316 17:77695960-77695982 GCAGGGAAGCAGGGATGGGCAGG + Intergenic
1152268590 17:79310528-79310550 TCCTAGAAGCAGGACGGGGCTGG - Intronic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1152650485 17:81490289-81490311 ACAGGGAAGGAGCTAGGGGCAGG - Intergenic
1153349094 18:4059033-4059055 ACAGAGATGCAGGCAGGGTTAGG + Intronic
1153935580 18:9917788-9917810 GCATAGAAGCAGCACGGGGCGGG + Intronic
1154534077 18:15379767-15379789 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1155056137 18:22185412-22185434 ACTGAGAAGCTGGGAGTGGCTGG + Intronic
1155143853 18:23067601-23067623 ACAGAAAAGAAGAAATGGGCAGG - Intergenic
1155273235 18:24161077-24161099 ACAGATTAGCAGTAAGGGGGAGG + Intronic
1155294324 18:24371508-24371530 CCTGAGAAGCAGGAAGGGATGGG - Intronic
1155350477 18:24901061-24901083 CCAGAGAAGTTGGAAGGGTCAGG - Intergenic
1155646138 18:28080086-28080108 AAAGAGAAACAGGAATGTGCTGG + Intronic
1156240219 18:35246745-35246767 ACAGAGCAGCAGGAAAGGTGGGG + Exonic
1156489063 18:37485691-37485713 ACCGAGCGGCAGGGAGGGGCGGG - Intronic
1156570718 18:38249897-38249919 ACAGAGAGGCAGGGAGGCCCAGG + Intergenic
1156789976 18:40959795-40959817 AGAGTGAAGCAGGAATTGGCCGG - Intergenic
1157358032 18:46953188-46953210 AAAGAAAAGGAGGAAGGTGCCGG - Intronic
1157479635 18:48045160-48045182 ACAGCCAAGCAGGCAAGGGCCGG + Intronic
1157511728 18:48280182-48280204 TCAGAGAAGGAGGAGTGGGCAGG + Intronic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1157621157 18:49018175-49018197 ACACAGGAGAAGGAAGGGACAGG + Intergenic
1157625342 18:49045952-49045974 ACAGTGCAGCAGGCAGAGGCAGG + Intronic
1157723041 18:49940338-49940360 ACAGAGTAGCAAGATGGTGCTGG + Intronic
1157893211 18:51438632-51438654 ACACAGAGGCAGGAGAGGGCAGG + Intergenic
1158791377 18:60784413-60784435 ACAGAGCAGCAGCAGGGCGCTGG - Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1160222494 18:76987488-76987510 GAAGAGAGGGAGGAAGGGGCAGG - Intronic
1160239423 18:77112553-77112575 ACAGAGAAGGGGGAGGGGGAGGG - Intronic
1160422522 18:78756763-78756785 CCAGAGAAAAAGGAAGGGGCGGG + Intergenic
1160535767 18:79590501-79590523 CCAGAGCAGCAGGAGGGAGCTGG + Intergenic
1160735748 19:661680-661702 GTAGAGACCCAGGAAGGGGCTGG - Intronic
1160761882 19:789593-789615 AGAGAAAGGCAGGAAGGGCCCGG - Intergenic
1160938436 19:1608914-1608936 ACTTCGGAGCAGGAAGGGGCAGG + Intergenic
1161052694 19:2173175-2173197 ACAGGGAAGGAGGAAAGCGCGGG - Intronic
1161052705 19:2173227-2173249 ACAGGGAAGGAGGAAAGCGCGGG - Intronic
1161284025 19:3459643-3459665 ACAGCCAGGCAGGAAGGGGAGGG + Intronic
1161440042 19:4285841-4285863 GAAGAGAAGGAGGAAGGGCCGGG - Intronic
1161608033 19:5225525-5225547 ACAAAGGAGGAGGCAGGGGCGGG + Intronic
1161740856 19:6020395-6020417 ACAGAGAAGACTGAAGCGGCTGG + Intronic
1161871909 19:6876817-6876839 ACAGAGTGCCGGGAAGGGGCAGG - Intergenic
1162886189 19:13699145-13699167 AGAAAGAAGCAGGCAAGGGCCGG + Intergenic
1162915108 19:13870501-13870523 ACATAGCACCAGGAAGGTGCAGG - Intronic
1162934394 19:13974190-13974212 TGAGTGAAGCAGGAAGGGGGTGG + Intronic
1163032701 19:14554670-14554692 ACAGGGAAGGAGGGAGGAGCAGG - Intronic
1163183170 19:15618242-15618264 AGAGAGAAGCAGGAAGGAAGGGG - Intronic
1163204905 19:15795213-15795235 GCAGAGAAGAAGGAAGGGGGAGG - Intergenic
1163214875 19:15869046-15869068 AGAGAGGGGAAGGAAGGGGCGGG + Intergenic
1163430166 19:17262694-17262716 CTTGGGAAGCAGGAAGGGGCAGG - Exonic
1163809104 19:19419310-19419332 TACGAGATGCAGGAAGGGGCTGG - Intronic
1163851646 19:19667788-19667810 AAAAAGAAGCAGGAGGCGGCTGG + Intergenic
1163861068 19:19743126-19743148 AAAAAGAACCAGGAAAGGGCAGG - Intergenic
1164421669 19:28099035-28099057 AAAGAAAAGCAGGAGAGGGCCGG + Intergenic
1164459934 19:28437942-28437964 TCACAGAAGCAGGAAGGGAGAGG + Intergenic
1164477334 19:28585693-28585715 ACAGAGAAGCAGTCTGGAGCTGG - Intergenic
1164573807 19:29393481-29393503 ACAGACAAGCAGGAAGGAGGGGG + Intergenic
1164649895 19:29884195-29884217 GGAGAGAAGGAGGAAGGGGAGGG - Intergenic
1164667543 19:30051517-30051539 ACAGAAAAGGAGGAGGGGGAAGG - Intergenic
1165116405 19:33531559-33531581 AAGGAAAAGAAGGAAGGGGCCGG + Intergenic
1165188856 19:34045294-34045316 AGAGAGAAGAAGGAAGGAACAGG + Intergenic
1165285688 19:34839603-34839625 ACAGAGGAGCATGAAGGAGGTGG - Intergenic
1165325381 19:35111619-35111641 ACAGGGAAGCAGGAAAGGGCAGG - Intergenic
1165821695 19:38680762-38680784 AAAGAGAAGGAGGAAGGTGAGGG - Intronic
1165840841 19:38788502-38788524 ACAGAGAAGGAGGCTGAGGCTGG - Intergenic
1165920935 19:39297614-39297636 ACAGAGAAGAAGGGTAGGGCTGG - Intronic
1166036006 19:40169096-40169118 AAAGAGAAGCAGAACAGGGCTGG + Intergenic
1166209945 19:41300032-41300054 ACAGAGGAGCAGGCTGAGGCTGG + Intronic
1166289305 19:41851559-41851581 ACAGGCAAGAAGGAAGGGGCAGG - Intronic
1166301595 19:41914548-41914570 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301609 19:41914608-41914630 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301622 19:41914668-41914690 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301629 19:41914695-41914717 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301636 19:41914722-41914744 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301643 19:41914749-41914771 ACAGAGACGGTGGAAGGGGAGGG - Intronic
1166301650 19:41914776-41914798 ACAGAGACGGTGGAAGGGGAGGG - Intronic
1166301702 19:41914972-41914994 ACAGAGATGCTGGAGGGGGAGGG - Intronic
1166722061 19:45002241-45002263 ACAGAGAATGAGGAGGGGGTGGG + Intronic
1166944684 19:46389808-46389830 AAGCAGGAGCAGGAAGGGGCAGG - Intronic
1167035063 19:46990305-46990327 ACAGAGAGGCAGGCTGGGGCAGG - Intronic
1167103649 19:47418774-47418796 ACAGAGAGGCAGAAAGGAGGAGG + Intronic
1167511324 19:49896757-49896779 ACTGAGAAGCAGTCAGGAGCTGG - Intronic
1167639601 19:50673380-50673402 ACAGAGGAGAAGGAAGAGGTGGG - Intronic
1167685704 19:50954759-50954781 ACAGGGAAGGAGGAAGGGGTGGG - Intergenic
1168254994 19:55160298-55160320 ACAGACACGCAGGGAGGGCCAGG + Intronic
1168266561 19:55226851-55226873 TCAGAGCAGCAGCAGGGGGCGGG + Exonic
1168338376 19:55609808-55609830 AGAGAGAAGCATGATGGGGAGGG - Intronic
1168433805 19:56302320-56302342 AAAGGGAAGGAGGAAGGGGAGGG - Intronic
1168677157 19:58286881-58286903 GCAGAGAGGGAGGAAGGGGTGGG - Intronic
925034941 2:677607-677629 ACAGAGGAGCAGGCGGAGGCGGG + Intergenic
925186479 2:1850126-1850148 AAAGGGAAGGAGGGAGGGGCAGG - Intronic
925350054 2:3194717-3194739 CCATGGAAGCAGGAAGGGGCCGG + Intronic
925574933 2:5350610-5350632 ACAGAAATGCATGACGGGGCTGG + Intergenic
925607618 2:5674384-5674406 ACAGAGAAGCAGAAAAGGAATGG - Intergenic
925649120 2:6070052-6070074 ACAGAGAGACAGGAAGAGCCAGG - Intergenic
925909321 2:8563001-8563023 ACAGGGAAACAGGGAGGGGTTGG + Intergenic
926095212 2:10077005-10077027 ACAGAAAATGTGGAAGGGGCAGG - Intronic
926696208 2:15771509-15771531 GAAGGGAAGGAGGAAGGGGCCGG - Intergenic
926797013 2:16627378-16627400 ACTGAGAAACCAGAAGGGGCAGG + Intronic
926806767 2:16718366-16718388 ACAGAGCATCTGGGAGGGGCAGG - Intergenic
927099105 2:19774254-19774276 AGAGAGAGGGAGGAAGGGGAAGG - Intergenic
927246550 2:20961270-20961292 TCAAAAAAGAAGGAAGGGGCCGG - Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927561649 2:24077563-24077585 CCAGTGAAGGAGGATGGGGCAGG - Exonic
927649204 2:24901121-24901143 AGAGCCGAGCAGGAAGGGGCAGG + Intronic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
927681079 2:25139437-25139459 ACAGAGGGGCAGGAAGTGGAGGG - Intronic
927732917 2:25491177-25491199 AGAGAGAGGGAGGAAGAGGCAGG + Intronic
928115872 2:28544900-28544922 ACAGAGAAGCTGGAGAGGGCAGG + Intronic
928512445 2:32014033-32014055 ACAGAGAGGGAGGGAGGGGAGGG + Intronic
928632498 2:33208453-33208475 ACAGGTTAGCAGGAAAGGGCTGG + Intronic
928687441 2:33763292-33763314 AGAGAGTAGCAGGAAGGGATAGG + Intergenic
928842829 2:35631474-35631496 ACAGGGAAGCAGGAAGATTCAGG + Intergenic
929071975 2:38039895-38039917 AAAAAGTAGTAGGAAGGGGCAGG - Intronic
929174440 2:38961962-38961984 CCAGAGGAACAGGAAGGGGCGGG + Intronic
929189410 2:39125235-39125257 ACAGAGAGGGAGGAAGAGGGCGG - Intergenic
929285200 2:40127746-40127768 CCAGAGAGGCAGGATGGGGTGGG + Intronic
929456744 2:42071581-42071603 ACAGAGAAGAAGAAAGGAGAGGG - Intergenic
929474082 2:42227686-42227708 GCAGAGGAGGAGGAAGGGGGCGG - Intronic
929931348 2:46258509-46258531 AGAGAGAAGGAGGAAGAGGAGGG + Intergenic
930021650 2:47005219-47005241 ACAGAGAGGAAGGGAGGGGGGGG + Intronic
930250879 2:49032836-49032858 TCATGGAAGCAGGAAGGGGGTGG - Intronic
930462841 2:51705556-51705578 ACAGATATGCAGGAAGAGGGTGG - Intergenic
931183475 2:59927054-59927076 AGTGAGAAGCAGGAGGGGGTAGG + Intergenic
931634475 2:64329186-64329208 ACGCAGAAGCAGGAAGGTCCAGG - Intergenic
931994865 2:67830220-67830242 ACAGAGAAGCCAGGAGGGTCTGG - Intergenic
932120120 2:69091010-69091032 AAAGAGGAACAGGAAGGGGTAGG + Intronic
932123342 2:69121117-69121139 ACACAAAAGGAGGAGGGGGCTGG - Intronic
932325848 2:70861204-70861226 CTAGAGAAGCAGGAAAGTGCAGG + Intergenic
932375255 2:71229635-71229657 AGTGAAGAGCAGGAAGGGGCTGG + Intergenic
932451495 2:71813480-71813502 ACAGAGGAACAAGAAGGAGCAGG + Intergenic
932468740 2:71940198-71940220 AGAGAGGAGGAGGCAGGGGCTGG - Intergenic
932487088 2:72090781-72090803 ACAGAGGCAGAGGAAGGGGCAGG - Intergenic
932496319 2:72147495-72147517 GCAGAGAGGAGGGAAGGGGCGGG + Intronic
932556050 2:72825755-72825777 ACAGAGGGGCGGGAACGGGCGGG - Intronic
932568045 2:72921661-72921683 ACAGAGAAGCAGGAGACTGCAGG - Intronic
932572527 2:72945547-72945569 ACAGAGAAGCAGGAGTGAGTGGG - Intronic
932573131 2:72948704-72948726 ACAGGGCAGCAGGTAGGAGCAGG + Intronic
933577867 2:84090373-84090395 AGAGAGAAGGAGGAAGGAGAAGG - Intergenic
933691475 2:85182342-85182364 ACTGAGAAGCAGGTGGGTGCTGG + Intronic
933811669 2:86036506-86036528 GCAGAGAGGAAGGAAGGGGGAGG + Intronic
933938754 2:87228102-87228124 AGAGAGAAGCAGGAGGCGGCTGG - Intergenic
934754067 2:96813177-96813199 AGAGAGAAGCAGGAATTAGCCGG + Intergenic
934982283 2:98852937-98852959 AGAGAGAAGAAGGAAGGAGAGGG + Intronic
935305791 2:101735202-101735224 CCAGAAAAGCAGGAAGGTTCTGG + Intronic
935699354 2:105797639-105797661 ACAGTGAGGCAGGAAGTGGCTGG + Intronic
935726040 2:106024786-106024808 ACAGAGAATAAGGAAAGGGAAGG - Intergenic
936049423 2:109211937-109211959 ACAGAAATGTGGGAAGGGGCTGG - Intronic
936081327 2:109434562-109434584 ACTCAGAAGCAGGAAGAGGGTGG - Intronic
936345760 2:111673723-111673745 ACCCAGACGCAGGCAGGGGCTGG + Intergenic
936354382 2:111737673-111737695 AGAGAGAAGCAGGAGGCGGCTGG + Intergenic
936590546 2:113799754-113799776 ACAAAGAAGCAGGAAGTGGGGGG - Intergenic
936809803 2:116384366-116384388 ACAGAAAAGCAGTAGGGGGCTGG + Intergenic
937132759 2:119525325-119525347 AGAGAGAAGAAGGAAGGGAGTGG - Intergenic
937302099 2:120848815-120848837 AAGGAGTGGCAGGAAGGGGCTGG + Intronic
937868203 2:126769570-126769592 ACAGAAAAGAAGGATGGGGCAGG - Intergenic
937905920 2:127052737-127052759 GCAGAGATGCTGGGAGGGGCAGG - Intronic
938064519 2:128273803-128273825 AAACAGAAGCAGGAAGAGGGCGG + Intronic
938196858 2:129335979-129336001 ACAGAAAAGCTGGAGGGGTCTGG - Intergenic
938316742 2:130334783-130334805 ACAGTCAAGCAGAAAGGAGCTGG + Intergenic
938532822 2:132206954-132206976 ACAGAGACGCAGGGAGGAGATGG - Intronic
938575453 2:132599007-132599029 ACAAGGAGGCAGGAAGGGGGTGG + Intronic
938652982 2:133402668-133402690 AGAGAGAAGGAGGAAGTGCCAGG - Intronic
938688402 2:133763342-133763364 ACAGACAAGCAGAAATGGCCTGG + Intergenic
939843372 2:147215274-147215296 ACAGAGAAGCAGCAATGTGAGGG + Intergenic
940017411 2:149121716-149121738 ACAGAGAAGCAGGACCTGCCGGG + Intronic
940143400 2:150520962-150520984 TCAGAGCAGGAGGAAGGAGCTGG - Intronic
940274564 2:151925680-151925702 AAAGAGGAGCAGGGAGGGGGTGG + Intronic
942006148 2:171701464-171701486 AAAGAAAAACAGCAAGGGGCTGG - Intronic
942810201 2:179990577-179990599 AGAAAGAAGAAGGAGGGGGCAGG + Intronic
942930968 2:181491779-181491801 ACAGAGGAGCAGGAATGGTAAGG - Intronic
943576691 2:189638748-189638770 ACAGAGATGCAGAAAAGGGATGG - Intergenic
944553932 2:200869537-200869559 CCAAAAAAGGAGGAAGGGGCAGG + Intergenic
945514996 2:210752618-210752640 ACATACAATAAGGAAGGGGCTGG - Intergenic
946029645 2:216694178-216694200 ACAGAGTAGGGGGAGGGGGCGGG + Intronic
946040730 2:216781123-216781145 ACAGAGAGGAAGGGAGGGGAAGG - Intergenic
946145161 2:217725111-217725133 AAAGAGAGGCAGGAAAGAGCAGG + Intronic
946316600 2:218919436-218919458 AAAGAAAAGAAGGAAGGGGAGGG - Intergenic
946981083 2:225216150-225216172 ACAGAGGATCAGGAAGTGTCAGG - Intergenic
947210241 2:227701707-227701729 CCAGAGAAGGAGGCAAGGGCTGG + Intronic
947298202 2:228656677-228656699 ACAGAGAATCTCAAAGGGGCTGG + Intergenic
947418701 2:229922469-229922491 TAAGACAACCAGGAAGGGGCGGG - Intronic
947448536 2:230183481-230183503 AGAGAGAAGAAGGAGAGGGCGGG + Intronic
947572793 2:231249157-231249179 AGACAGCAGCAGGATGGGGCAGG - Intronic
947774514 2:232697243-232697265 GGAGGGAAGCGGGAAGGGGCGGG + Intergenic
947794478 2:232885415-232885437 ACCGAGCTGGAGGAAGGGGCCGG - Intronic
947865516 2:233395611-233395633 AGAGAGAAGCGGGGAGGGGAGGG - Intronic
947872503 2:233447203-233447225 ACAGAGAGGTGGGACGGGGCAGG - Intronic
947981991 2:234418525-234418547 AGAAAGAAGCAGGCAGGGGTGGG - Intergenic
948507931 2:238442981-238443003 AAAGACAAGCAAGAAGGGGGTGG - Intronic
948530381 2:238600142-238600164 ACAGCAAAGCAGGATGAGGCAGG + Intergenic
948569835 2:238910966-238910988 TCAGAGAAGCAGGGAGGTGGTGG - Intergenic
948596657 2:239083735-239083757 ACACAGCAGCAGGAAGGCACGGG + Intronic
948608023 2:239148255-239148277 AAAGTGCAGAAGGAAGGGGCTGG + Intronic
948635395 2:239331308-239331330 GAAGACAAGCAGGAAGGGGTGGG + Intronic
948672929 2:239580023-239580045 TTAGAGAACCAGGAAGGTGCAGG + Intronic
948771106 2:240251622-240251644 ACAGAGAAGCAGCCAGGCCCAGG - Intergenic
948783620 2:240339912-240339934 AAAGGGAAGAAGCAAGGGGCTGG - Intergenic
949051989 2:241902472-241902494 ACAGGGGCGCAGGACGGGGCTGG - Intronic
1168832359 20:853552-853574 ACAGAGAAGGTGGGTGGGGCTGG + Intronic
1169316305 20:4593363-4593385 ACAGAGAAGCAAGAAGATGCTGG - Intergenic
1169535410 20:6533717-6533739 AAAAAGAAGCAGGCAGGGGTGGG - Intergenic
1169677669 20:8172831-8172853 CCAGAGAAGCAGCATGGGGCAGG + Intronic
1169933529 20:10858652-10858674 AGAGAGGAGCTGGAAGGGTCAGG + Intergenic
1169986697 20:11453014-11453036 AGAGAGAAACAGGAAGAGGTAGG + Intergenic
1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG + Intronic
1170545657 20:17433888-17433910 GGAGAGAAGTAGGAAGGGGGGGG - Intronic
1170574564 20:17652665-17652687 CCAGAGAAGCTGGAGTGGGCAGG + Intronic
1170705276 20:18738745-18738767 GCAGGGAGGGAGGAAGGGGCTGG + Intronic
1170728863 20:18955010-18955032 ATAGAGAAGCAGGGAAGGGCAGG - Intergenic
1170773198 20:19352035-19352057 GGAGAGAAGCAGGACAGGGCAGG + Intronic
1171131324 20:22656102-22656124 ACAGAAAAACAGGAAGAGACAGG + Intergenic
1171249664 20:23638159-23638181 ACAGGGAAGCCTGGAGGGGCAGG - Intronic
1171355991 20:24545741-24545763 TCAGAGAAGCAGGACTGGGTGGG - Intronic
1171464363 20:25317380-25317402 ACAGGGAAGCTGGGAGGGTCTGG - Intronic
1172020666 20:31911548-31911570 CCAGAGATGCAGGATGGGCCAGG - Intronic
1172026953 20:31955053-31955075 AGAGAGAAGCAGGAAGCCACAGG - Intergenic
1172107646 20:32526345-32526367 ACCGAGAAGCAGGAGGGGCGGGG + Intronic
1172228769 20:33323148-33323170 GAAGAGAAGAAAGAAGGGGCAGG + Intergenic
1172424859 20:34848998-34849020 TCAGAGAGGCAGGCAGGCGCCGG - Intronic
1172479790 20:35264244-35264266 GGAGAGAAGCATGAAGGGACGGG - Intronic
1172628522 20:36362789-36362811 ACAGGAAAGCAGGCAGGGACAGG + Intronic
1172762760 20:37333649-37333671 GCAAAGAAGCAGGAAGGGAAAGG - Intergenic
1172926985 20:38546833-38546855 AGTGAGTAACAGGAAGGGGCAGG - Intronic
1173595435 20:44256030-44256052 AGAAAGACTCAGGAAGGGGCAGG + Intronic
1173619535 20:44426206-44426228 ACAGAGAAACAGAAAGAAGCGGG + Intronic
1174079488 20:47960868-47960890 GCAGGGATGCAGGAAGGGGTGGG - Intergenic
1174511921 20:51059952-51059974 TGAGAGAAGCAGGATGGAGCAGG + Intergenic
1174525742 20:51169607-51169629 ACAAAGAAGCAGGAAAAGGTGGG - Intergenic
1174615031 20:51828951-51828973 CCAGAGAAGCAGCAGGGGACCGG - Intergenic
1174675879 20:52355024-52355046 ATAAAGAAGCAAGAATGGGCTGG - Intergenic
1174699595 20:52594612-52594634 ACAGAGCAGCAGGATGGTGAGGG - Intergenic
1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG + Intergenic
1174962380 20:55173069-55173091 ACTGATAAGTAAGAAGGGGCAGG - Intergenic
1175220046 20:57411653-57411675 ACAGGCAGGCAGGAAGGGCCGGG + Intergenic
1175374710 20:58516049-58516071 AAAGAGAACCAGGAAGGAGGAGG + Intergenic
1175682366 20:60999039-60999061 CCAGAAAAGCAGGGAGGAGCAGG + Intergenic
1175688188 20:61046406-61046428 ACAGTGACCCAGGCAGGGGCTGG + Intergenic
1175748110 20:61475600-61475622 ACAGAGAGGGAGGGAGGAGCAGG - Intronic
1175779063 20:61670816-61670838 ATAGAAAGGAAGGAAGGGGCTGG + Intronic
1175791721 20:61744247-61744269 ACAGAGAGGAAGGCAGGTGCAGG + Intronic
1175943093 20:62546865-62546887 ACAGACAAGGATGTAGGGGCAGG + Intergenic
1176081290 20:63274462-63274484 ACAGTGAAGGAGGGAAGGGCTGG + Intronic
1176085043 20:63292090-63292112 CCAGAGCAGCAGGCAGGGTCGGG + Intergenic
1176139424 20:63538419-63538441 ACAAGGGGGCAGGAAGGGGCGGG + Intergenic
1176957626 21:15124330-15124352 ACAGGGAAGAAGGAGGGGGAAGG + Intergenic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178600686 21:33991987-33992009 AGGGAGAAGCAGAAAGGTGCAGG + Intergenic
1178693967 21:34776825-34776847 AGAGATAAACAGGAATGGGCTGG - Intergenic
1179353542 21:40636397-40636419 AGAGGGAAGAAGGAAGGGGGTGG + Intronic
1179441026 21:41394248-41394270 TCAGAGAGGCAGGCAGGGCCAGG - Intronic
1179468760 21:41596703-41596725 ACCGAGAAGCTGGAAGCAGCAGG + Intergenic
1179979076 21:44887144-44887166 ACAGAGAAGAAGGCAGGGCCAGG + Intronic
1180510820 22:16087280-16087302 ACAGAGACGCAGGGAGGAGATGG + Intergenic
1180636158 22:17264588-17264610 ACAGAGAAGGAGGGAGGGAGGGG - Intergenic
1180693526 22:17737703-17737725 ACAGAGTGGAAGGAAGGGGCTGG - Intronic
1180862068 22:19089224-19089246 ACAGAGAGAGAGGAAGGGGTCGG + Intronic
1181030462 22:20146977-20146999 AGAGAGAAGCAGAAAGGTGGAGG - Intronic
1181085770 22:20438676-20438698 ACAGAGCAGAAGGAAGGTGTGGG + Intronic
1181118585 22:20650154-20650176 GCAGAGTAGCAGGAAGAAGCAGG + Intergenic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181735822 22:24880710-24880732 AAATGGAAGCAGGAAGGGGTGGG + Intronic
1181760068 22:25052122-25052144 AGAGAGGAGCTGGCAGGGGCTGG - Intronic
1182082446 22:27538893-27538915 ACAGGGAAGGAGGAAGGGGGAGG - Intergenic
1182352448 22:29706518-29706540 GCAGAGAAGGAGGAAGAGGGAGG + Intergenic
1182359838 22:29739965-29739987 ACAGAGAAGCTTAAGGGGGCAGG + Intronic
1182449237 22:30408886-30408908 ACAGTGACTCAGGAAGGGGGAGG + Intronic
1182586807 22:31348083-31348105 ACAGAGAAAGAGAAAGGGGCCGG + Intergenic
1182713487 22:32336986-32337008 AAAGAAAAGCAGGACAGGGCTGG + Intergenic
1182886386 22:33777623-33777645 ACAGAGAGGGAGGGAGGGGAAGG + Intronic
1183101616 22:35587688-35587710 ACAGAGCAGAAGGAAGAGGATGG + Intergenic
1183217719 22:36491923-36491945 ACAGAGTGTCAGGAATGGGCTGG + Intronic
1183232440 22:36591381-36591403 AGAGGGAAGAAGGGAGGGGCTGG + Intronic
1183445944 22:37854995-37855017 CCAGAGAAGCAGGAGGGGTGGGG + Intronic
1183752926 22:39732333-39732355 TGACAGAAGCAGGCAGGGGCAGG - Intergenic
1183863293 22:40684711-40684733 AGTGAGGAGCAGGCAGGGGCTGG - Intergenic
1184294671 22:43515826-43515848 CCAGGAAGGCAGGAAGGGGCAGG + Intergenic
1184610352 22:45599329-45599351 ACAGGGAAGCAAGAGGTGGCTGG - Intronic
1184782353 22:46655684-46655706 TCAGAGCAGCAGGAAGGAGGTGG - Intronic
1184807923 22:46808059-46808081 ACAGAAATGCAGTAAGGGGCTGG + Intronic
1184810818 22:46830525-46830547 ACAGAGCAGAAGCAAAGGGCTGG + Intronic
1184817747 22:46884911-46884933 TCAGAGAGGCAGGAAGGGCCAGG + Intronic
1184846207 22:47089062-47089084 ACAGAGAAGCAAGAAAGAGGAGG + Intronic
1184920337 22:47601102-47601124 ACACAGAGGCTGGGAGGGGCAGG - Intergenic
1184972677 22:48037717-48037739 CCAGGGAGGCAGGAAGGTGCAGG + Intergenic
1185263637 22:49885745-49885767 CTGGAGAAGTAGGAAGGGGCGGG - Exonic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949415085 3:3805414-3805436 ACAGAGAATCAGGAAGGCGCAGG + Intronic
949501171 3:4681161-4681183 GCAGTGAGGGAGGAAGGGGCAGG + Intronic
949895103 3:8762695-8762717 CCACAGAAACAGGGAGGGGCTGG + Intronic
950098785 3:10345023-10345045 AGAGGGAGGCAGGGAGGGGCAGG - Intronic
950549592 3:13658114-13658136 ACAAAGAAGCAGCAAGGGAGGGG - Intergenic
950668631 3:14512145-14512167 GCCCAGAGGCAGGAAGGGGCAGG + Intronic
951830901 3:26925851-26925873 GCAGAGGAGCAGGAATGGCCTGG + Intergenic
951839929 3:27023440-27023462 TAAGAGAAGCAGGATAGGGCAGG + Intergenic
952817270 3:37456528-37456550 GCAGAGAAGGAGGAGGGGACGGG - Intronic
953006622 3:38984979-38985001 GCAGAGATGTAGGCAGGGGCTGG + Intergenic
953038931 3:39237786-39237808 GGAGGGAAGCAGGATGGGGCAGG - Intergenic
953226599 3:41027191-41027213 ACAAAGAGGCAGGAAGGGAAGGG + Intergenic
953538645 3:43795049-43795071 ACAGGGAAACAGGAAGAAGCTGG - Intergenic
953557337 3:43956912-43956934 TCAGAGAAGAATGAAGGAGCAGG + Intergenic
953720071 3:45347526-45347548 ACTGAGAAGCAGGGAGCAGCAGG + Intergenic
953786622 3:45916153-45916175 GCAGAGTGGCAGGGAGGGGCGGG + Intergenic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
953969349 3:47334890-47334912 ACAGAGAAACCAGAAGGGCCAGG - Intronic
953980403 3:47410511-47410533 ACAGGGAAGCAGGGCGGGGGAGG - Exonic
954132449 3:48567524-48567546 ACAGGGAGTCAGGATGGGGCAGG - Intronic
954293990 3:49664107-49664129 GCAGAGAAGCAGGAAGGCACTGG + Intronic
955107041 3:55908413-55908435 ACAGGGAGGCAGGAAAGGCCAGG + Intronic
955112360 3:55961316-55961338 TCAGTGATGAAGGAAGGGGCAGG - Intronic
955146994 3:56329582-56329604 ACAGGAAAGCTAGAAGGGGCTGG - Intronic
955403926 3:58613491-58613513 CCAGAGCAGCAGGCAGGGGCTGG - Intronic
955404497 3:58617438-58617460 ACAGGGAAGCTGGAAGAGCCTGG - Intronic
956429247 3:69167807-69167829 ACAGAGAAACAGGCCGGGCCTGG + Intergenic
956710621 3:72035607-72035629 GCACAGATGAAGGAAGGGGCTGG - Intergenic
956761763 3:72449958-72449980 ACAGAGGAGCAGGGACTGGCTGG - Intergenic
957071144 3:75568781-75568803 ACAGACAAGCGGGTAGGGGCTGG + Intergenic
957259644 3:77884351-77884373 AGAGAAAAGCAAGAAGGGACAGG - Intergenic
957956546 3:87195883-87195905 ACAGAGCAGCAGGGAGGCCCTGG - Intergenic
958072229 3:88629057-88629079 TCAGCGAAGCAGGAAAAGGCAGG - Intergenic
958193759 3:90216650-90216672 AAAGAGAAGCAAGCAGGGTCAGG - Intergenic
958752193 3:98204560-98204582 AGAGAGAAGCAGGAAGGACCAGG - Intergenic
959381148 3:105642445-105642467 ACAGGGAAACAGGCAGAGGCTGG - Intergenic
959685380 3:109140387-109140409 ACACAGGAACAGGAAGGGCCAGG + Intergenic
959933073 3:112003356-112003378 GCAGAGAAGCAGGAAGAGGGAGG + Intronic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960854880 3:122092659-122092681 AAGGAGCAGCAGGAAGGGGTGGG - Intronic
960869038 3:122230825-122230847 ACAGAGAAGTAGAAGGGGCCAGG - Intronic
960912772 3:122665938-122665960 AAAGAGAAGCAGTAGGGGCCTGG + Intergenic
961282964 3:125777936-125777958 GCAGACAAGCAGGTAGGGGCTGG - Intergenic
961581547 3:127887454-127887476 ACAAAGAAGGAGGATGTGGCTGG + Intergenic
961731897 3:128971510-128971532 ACAGAGATTCAGGAAGGTTCTGG + Intronic
962061760 3:131935299-131935321 AAAATGAAACAGGAAGGGGCTGG + Intronic
962367650 3:134796630-134796652 ACAGAGGCGGGGGAAGGGGCGGG - Intronic
962902379 3:139772584-139772606 ACAGAGAAGCAACAAGGGAGTGG + Intergenic
962957187 3:140276910-140276932 GCAGAGAAGCAGGGAGAGGCAGG + Intronic
963057712 3:141200973-141200995 AGAGAGAAGAAGGCAGGAGCAGG + Intergenic
963234944 3:142947313-142947335 CCACAGGAGGAGGAAGGGGCAGG + Intergenic
964185723 3:153940347-153940369 AAAGAGAAGCAGGGAGTGGGTGG - Intergenic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
965629268 3:170714308-170714330 ACAGAGAAGCAGTCAGCGGATGG - Intronic
965686971 3:171314460-171314482 ACAGAGAGGCAGAAATGGGATGG - Intronic
966554230 3:181241106-181241128 ATAGAGAAGCTGGAAGGGGTGGG + Intergenic
966923601 3:184630212-184630234 AAATAAATGCAGGAAGGGGCTGG + Intronic
967356486 3:188577818-188577840 AGAAAGAAGAAGGAAGGGGAGGG - Intronic
967852699 3:194094028-194094050 ACAGAAAACCAGGAAGGAGGCGG - Intergenic
967923428 3:194629437-194629459 ACGGAAGGGCAGGAAGGGGCTGG + Intronic
968286676 3:197513049-197513071 ACAGAGCAGCAGGCAGGGGCAGG + Intronic
968572479 4:1349320-1349342 ACACAGAAACAGGCAGGGGCTGG + Intronic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
968738073 4:2309227-2309249 GCAGAGAAGCAGGAGGGGAAGGG - Intronic
968821980 4:2861134-2861156 ACTCTGAGGCAGGAAGGGGCTGG + Intronic
969014753 4:4096486-4096508 GCAGACAAGCAGGTAGGGGCTGG + Intergenic
969211051 4:5687521-5687543 GCAGGGAAGCAGGAAGGGGCAGG + Intronic
969540349 4:7784640-7784662 CCAGAGCAGCAGGAAGGAGGAGG + Intronic
969739189 4:9011962-9011984 GCAGACAAGCGGGTAGGGGCTGG - Intergenic
969798377 4:9543475-9543497 GCAGACAAGCGGGTAGGGGCTGG - Intergenic
969868700 4:10091855-10091877 AGAGAGCTGCAGGAAGGAGCCGG + Intronic
970227134 4:13870887-13870909 AAAGAGAAGAATGAAGGGCCAGG - Intergenic
970563688 4:17309753-17309775 ACAGAGAAACAGGCAAGGGCAGG + Intergenic
971001950 4:22333144-22333166 AAGGAGAAGCAGGCAGGAGCTGG - Intergenic
971017763 4:22506143-22506165 GGGGAGAAGCAGGAAGGTGCTGG + Intronic
971377902 4:26069796-26069818 ACAGAAAGGCAGAAAGGGCCTGG - Intergenic
972056461 4:34808673-34808695 ACAGAAAAGCATGAAAGGGGGGG - Intergenic
972716919 4:41655822-41655844 AAAGAGCTGCAGGAAGGGCCAGG - Intronic
973086573 4:46069991-46070013 ACAAAGAGGCAGTAAAGGGCAGG + Intronic
973908557 4:55555209-55555231 ACAGAGAATCATGAAGTGGAAGG - Intergenic
974693957 4:65340436-65340458 ACAGAGCAGCAGGAAGCAGTTGG + Intronic
974806709 4:66889977-66889999 AAAGCTAAACAGGAAGGGGCAGG - Intergenic
975079309 4:70256298-70256320 ACAGAGGAGCTGGGAGGGCCAGG - Intergenic
975260059 4:72287512-72287534 AGAGAGAGCCAGGAAGAGGCAGG + Intronic
976226960 4:82801626-82801648 ACACAGAAGCAGGGAGGAGGGGG + Intergenic
976482673 4:85563035-85563057 TGAGGGAAGCAGGATGGGGCAGG + Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
977243578 4:94603304-94603326 ACACAGGGGCTGGAAGGGGCAGG + Intronic
977797529 4:101184948-101184970 ACAGAAATGCAAGAAGGAGCAGG + Intronic
977858379 4:101924523-101924545 AAACAGAAGCAGAAAGGGTCAGG + Intronic
978102549 4:104860346-104860368 ACAGAGAGGCAGGAAAGGAAAGG + Intergenic
978674529 4:111295112-111295134 ACAGAGAAGCAGGGAAAGGTAGG + Intergenic
979906560 4:126300737-126300759 ACAGAGTAGGAGGGAGGTGCTGG + Intergenic
979940923 4:126761922-126761944 ACACAGAAGTAGGAAGGGAAAGG + Intergenic
980784324 4:137532638-137532660 ACGGAGAAGGAGGAAGGCGGGGG + Intergenic
980904839 4:138938158-138938180 ACAGAGCCTCAGGAGGGGGCTGG - Intergenic
980969348 4:139555393-139555415 CCAGCCAAGCAGGAAGGGGGAGG + Intronic
980971170 4:139568598-139568620 AGAAAGAAGCAGCAAGGGTCAGG + Intronic
981092130 4:140742845-140742867 AGAGAGAAGAAAGAAGGTGCAGG + Intronic
981390003 4:144178333-144178355 ACAGAGAGACAGAAAGAGGCTGG - Intergenic
982612114 4:157588448-157588470 AGAGAGAGGCAGGGAGGTGCCGG + Intergenic
982943075 4:161583257-161583279 ACAGGGAAACAGGAAGAGGGAGG - Intronic
982946446 4:161630119-161630141 ACGGAGGGGCAGGAAGGGGAGGG - Intronic
983081252 4:163387671-163387693 GCAGAGAAGCAGTACGAGGCAGG + Intergenic
984624918 4:181996259-181996281 ACAGTGAAGGATGAAGTGGCTGG + Intergenic
984658257 4:182343569-182343591 GCAGAGAAGTGGGAAGAGGCAGG - Intronic
985078066 4:186237808-186237830 ACAGAGAGGTGGGAAGGGGGCGG - Intronic
985132143 4:186749671-186749693 GAAGAGAGACAGGAAGGGGCTGG - Intergenic
985648746 5:1097702-1097724 ACAGAAAAGCAGGGTGTGGCTGG + Intronic
985667077 5:1186882-1186904 AGAGAAAAGCAGGAGGGGGTGGG - Intergenic
985724288 5:1507604-1507626 TCAGGGAAGCTGGCAGGGGCCGG + Intronic
985768046 5:1791329-1791351 CCACAGAAGCTGGAAGAGGCAGG + Intergenic
985797437 5:1973427-1973449 ACACAGAAGTAGGAAGAGGTTGG - Intergenic
985797655 5:1975178-1975200 AGAGAGAATCAGGAAGGGGAAGG + Intergenic
985806051 5:2044260-2044282 ACAGAGAAGCTGGAGGGCACGGG + Intergenic
985963518 5:3321977-3321999 ACAGAGTAGCAGGGAGAGCCAGG + Intergenic
985992340 5:3573899-3573921 ACAGAGAAGGTGGAAGGGACAGG + Intergenic
986065668 5:4231377-4231399 ACAGAGAAGCAGCCAGGGCGAGG - Intergenic
986613878 5:9597110-9597132 ACAGAGGAGGAGGAAGGGGAAGG - Intergenic
986773509 5:10994358-10994380 GCGGGGAAGGAGGAAGGGGCCGG + Intronic
987261298 5:16206126-16206148 AGAGTGCAGCAGGAAGGAGCCGG + Intergenic
987292358 5:16520858-16520880 AAAGAGGAGCAGGAGGTGGCAGG + Intronic
988326627 5:29776903-29776925 ACAGAAAGGCTAGAAGGGGCTGG + Intergenic
988439502 5:31216326-31216348 ACACAAAAGCAGGCAGTGGCTGG - Intronic
988907228 5:35802141-35802163 ACAGAGAGGCAGGAAAGGAGAGG - Intronic
989122895 5:38021760-38021782 ATAGAGGAGAAGGAAGGGGAAGG - Intergenic
990874226 5:60466797-60466819 ACTGAGAACAACGAAGGGGCAGG - Intronic
991014453 5:61915996-61916018 ACACAGAAGGAGGAAGGGCGAGG - Intergenic
991024086 5:62011177-62011199 ACAGGGAAGCAGGCAGGAGCAGG + Intergenic
991707211 5:69369543-69369565 AGGGAGGAGCCGGAAGGGGCGGG + Exonic
991963316 5:72066974-72066996 ACAGATAAGCAGAGAAGGGCTGG + Intergenic
992865638 5:80954454-80954476 CAGGAGAATCAGGAAGGGGCTGG + Intergenic
992900729 5:81292450-81292472 AGAGAGGAGCAGTTAGGGGCTGG - Intergenic
993053474 5:82952711-82952733 TTAGAGAAACAGGCAGGGGCTGG - Intergenic
993227999 5:85194367-85194389 ACAGAGTACTAGGATGGGGCAGG - Intergenic
994278950 5:97876741-97876763 ACAGAGAAGGAGTCAGGTGCTGG + Intergenic
995336080 5:111001382-111001404 ACTGAAAAGCAGGAAGGGCAAGG + Intergenic
995397216 5:111699666-111699688 ACAGAGAAGGAGGAACTGGTGGG - Intronic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
995580269 5:113592157-113592179 GCAGATAAGCAGGGATGGGCAGG + Exonic
995690647 5:114822986-114823008 ACAGAAAAAAAGGCAGGGGCAGG + Intergenic
996238894 5:121170518-121170540 CCAGAGCAGGAGGAAGTGGCAGG + Intergenic
996560515 5:124823579-124823601 ACAGAGATGCAAGAGGTGGCAGG + Intergenic
997434136 5:133862030-133862052 ACTGAGAAGCAGGAGGGGCCAGG + Intergenic
997559672 5:134835351-134835373 ATTGAAAAGCAGGAAGAGGCCGG + Intronic
997690512 5:135824757-135824779 ACTGAGAAGGAGGCACGGGCTGG + Intergenic
997789721 5:136747313-136747335 AAAGGGTAGTAGGAAGGGGCGGG + Intergenic
998114531 5:139526096-139526118 AGAGAGAAGCAGAACAGGGCAGG - Intergenic
998161380 5:139814661-139814683 ACAGAGAAGCCAGCAGGAGCTGG + Intronic
998306282 5:141080277-141080299 CCAGAAAAGTAGGCAGGGGCTGG + Intergenic
998575899 5:143316189-143316211 CCAGAGAAGTAGGAAGGTCCTGG + Intronic
998616042 5:143741594-143741616 ACAGAGAAAAAGGAAGGAGAAGG + Intergenic
999087424 5:148905040-148905062 ACTGAGACACAGAAAGGGGCAGG - Intergenic
999249670 5:150175082-150175104 ACAAAGAAGCTGAAAGAGGCAGG - Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999378167 5:151101345-151101367 CCAGAGACTAAGGAAGGGGCAGG - Exonic
999636553 5:153629060-153629082 ACAGAGAGACAGGCAGGGGTGGG + Intronic
999664480 5:153898392-153898414 ACAGAGAGGCAGCAGTGGGCAGG + Intergenic
999707378 5:154285858-154285880 ACAGAGAAGCAGGGAAAGTCTGG - Intronic
999719830 5:154391447-154391469 ACAGAGAAGGAGGGAGGGAAAGG - Intronic
1000328220 5:160188134-160188156 GGAGAAAAGCAGGCAGGGGCCGG + Intronic
1000363334 5:160468089-160468111 ACAGCGAGGGAGGAAGAGGCTGG - Intergenic
1000367734 5:160506561-160506583 AGAGAGAATCAGGTAGGGGAGGG + Intergenic
1000767910 5:165315178-165315200 AGAGAGAAGAAGGAAGAGACAGG + Intergenic
1001040881 5:168334319-168334341 GCAGAGAAACAGGATGGGGCCGG - Intronic
1001240734 5:170067907-170067929 AGGGAGGGGCAGGAAGGGGCAGG + Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1002014422 5:176308147-176308169 ACAGAGAAGGAGGAAGTGATGGG + Intronic
1002189399 5:177470866-177470888 ACAGGGAATCAGGATGGGGTAGG + Intronic
1002502271 5:179654733-179654755 ACAAAAAAGCATGAAGGGGCCGG - Intergenic
1002612927 5:180433213-180433235 AGAGTGAAGCAGGAAGTGGCAGG - Intergenic
1002850905 6:995635-995657 AGAGGGAAGGAGGCAGGGGCTGG - Intergenic
1002984639 6:2177007-2177029 AGAGAGAAACAGGAAAGGGCAGG + Intronic
1004313014 6:14562512-14562534 ACAGGGAAGCAGAATTGGGCAGG - Intergenic
1004649346 6:17593563-17593585 GAAGAGAAGGAGGAAGGGGGAGG - Intergenic
1005624610 6:27651624-27651646 ACAGAGAAGGAGGGAGGGAGAGG + Intergenic
1005949023 6:30617438-30617460 ACAGGGAGGCAGGAAGGAGGCGG - Intronic
1006081393 6:31569429-31569451 ACAGAGAAAAAGAAAGGAGCAGG + Intergenic
1006110519 6:31741903-31741925 GCAGAGAAGAAGCAAGGGGGAGG + Intronic
1006155584 6:32011294-32011316 ACAATGACGCAGGCAGGGGCAGG + Intergenic
1006161916 6:32044148-32044170 ACAATGACGCAGGCAGGGGCAGG + Intronic
1006175443 6:32118612-32118634 ATAATGGAGCAGGAAGGGGCTGG + Intronic
1006273264 6:32980782-32980804 ACAGCAAAGGGGGAAGGGGCAGG - Exonic
1006362996 6:33597870-33597892 TCAGAGAAGTAGGAAGGGAATGG + Intergenic
1006369285 6:33634094-33634116 ACAGGGGAGCAGGAGGGGACGGG - Intronic
1006653982 6:35574603-35574625 ACAGAGAAGCTTGACAGGGCAGG + Exonic
1006675290 6:35758370-35758392 TGAGAGAAGCAGGAAGGGCATGG + Intergenic
1006697479 6:35943480-35943502 ACAGAGAAGGGAGAAGGTGCAGG + Intergenic
1007184872 6:39961215-39961237 AATGAGAAACAGGAAGGAGCTGG - Intergenic
1007292070 6:40795406-40795428 ACAGACAGCCAGGAAGTGGCAGG + Intergenic
1007351573 6:41277378-41277400 AGAGACAGGCAGCAAGGGGCAGG + Intronic
1007375017 6:41450715-41450737 ATAGAGCCGCAGGAAGGGCCTGG + Intergenic
1007452609 6:41951603-41951625 AGAGAGAAGCAGGAAGAAGAGGG + Intronic
1007549633 6:42719250-42719272 CCAGAGAAGCAGGGAGGCGGGGG - Intronic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007815965 6:44525857-44525879 ACAGAGTAGTAGGAGGAGGCTGG - Intergenic
1008046931 6:46860614-46860636 ACAGAGAAGCTGCAATGGGGAGG + Intronic
1008179690 6:48313004-48313026 AAATAGAAGGAGGAAGAGGCAGG + Intergenic
1008543391 6:52564972-52564994 GCAGAGAAGCATGAAGGAGGAGG + Intronic
1009443706 6:63713632-63713654 ACAGAGAAGGAGAAAAGGACAGG + Exonic
1009650998 6:66478469-66478491 ATAGAGAAGCAGGACTGGGAAGG - Intergenic
1010991205 6:82482310-82482332 AGAGAGAAGGAGGAAGGGGCTGG - Intergenic
1011012151 6:82714729-82714751 AGAGAGAAGGAGGAAGAGCCAGG + Intergenic
1011441221 6:87389587-87389609 ATACAGAAACAGGCAGGGGCTGG + Intronic
1011528016 6:88287668-88287690 ACTGAGAAGCTGGAAGAGGCTGG - Intergenic
1011798592 6:90983753-90983775 CACCAGAAGCAGGAAGGGGCAGG - Intergenic
1012624757 6:101392656-101392678 ACAGTGAAGCAGGGAGAGCCTGG + Intergenic
1012788527 6:103661561-103661583 AAAGAAAAGGAGGAAGGGCCGGG - Intergenic
1012926435 6:105272870-105272892 ACTGAGAAGCAGGCAGGGGGAGG - Intergenic
1013269631 6:108533998-108534020 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013269643 6:108534054-108534076 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013269826 6:108535215-108535237 GCAGAGAAGCCGGAAGGTGAAGG - Intergenic
1014568080 6:122975774-122975796 AAATGGAAGCAGGAAGGAGCTGG - Intergenic
1015245192 6:131066740-131066762 ACAGAGAAACAGGGATGGACTGG + Intergenic
1015577663 6:134690161-134690183 TCAGAGATGCAGGATGGGGTTGG - Intergenic
1015585405 6:134771058-134771080 ACTGAAAAGCAGGACGTGGCTGG - Intergenic
1015722817 6:136262967-136262989 ACAGATCAGCAGGAAGTGCCCGG + Intronic
1015935237 6:138402306-138402328 ACAGGGAAGGAGGCAGGGCCAGG + Intergenic
1016474073 6:144407006-144407028 TCAGACAAGCAGGAAGGGGTAGG - Intronic
1016554808 6:145324527-145324549 CCCGAGAGTCAGGAAGGGGCTGG + Intergenic
1016755234 6:147677605-147677627 TCAGAGTAGCATAAAGGGGCTGG + Intronic
1016788558 6:148041122-148041144 ACAGATAAGCAAGAAAGGGAAGG - Intergenic
1017467803 6:154710960-154710982 ACAGGGAAGGAGGATGGGGCTGG - Intergenic
1017765367 6:157602826-157602848 ACAGGCTAGCACGAAGGGGCTGG - Intronic
1018171751 6:161148984-161149006 ACAGAGGATCCGGAAGGAGCTGG + Intronic
1018651907 6:165999220-165999242 AGAGAGAAGCGTGAAGGAGCTGG - Intergenic
1018670305 6:166171529-166171551 CTAGAGCAGCAGGGAGGGGCCGG - Intergenic
1018938918 6:168295069-168295091 GCAGAGGAGGAGGAAGGGGCAGG - Intronic
1019128959 6:169859755-169859777 ACAGAGGAGCAGGGAGAGACAGG - Intergenic
1019159009 6:170057268-170057290 ACAGAGAAGCCTGCAGGGCCAGG - Intergenic
1019304786 7:328142-328164 ACAGAGAACCAGGCAGGTGTGGG - Intergenic
1019742832 7:2683313-2683335 CCCCAGAAGCAGGAAGAGGCAGG - Intronic
1020074854 7:5251166-5251188 CACGAGAAGCTGGAAGGGGCAGG - Intergenic
1020080450 7:5283415-5283437 TCCGAGAACGAGGAAGGGGCCGG - Intronic
1020169793 7:5836186-5836208 GCACAGGGGCAGGAAGGGGCTGG + Intergenic
1020357471 7:7293008-7293030 ACAGAGAAGTATGCTGGGGCAGG - Intergenic
1021797056 7:24266364-24266386 ACAAAGAAGAAGGCAGGGGCTGG + Intergenic
1022025457 7:26444101-26444123 ATAAAGAAGCAATAAGGGGCAGG - Intergenic
1022616685 7:31938408-31938430 CCAGATAAGCTGGAAGGGGTGGG + Intronic
1022660373 7:32361326-32361348 ACAGACAGGGATGAAGGGGCTGG - Intergenic
1022703009 7:32778868-32778890 AATGAGAGGCAGCAAGGGGCAGG - Intergenic
1023021662 7:36016952-36016974 AGAGAGAGGCAGGATGGGGCTGG - Intergenic
1023071740 7:36441573-36441595 ACTGAGGAGCAGCAAGAGGCAGG + Intronic
1023146149 7:37153011-37153033 TCAGAGAAGGAGTGAGGGGCAGG + Intronic
1023870149 7:44258935-44258957 ACAGAGAAGCCATGAGGGGCTGG + Intronic
1024058600 7:45682194-45682216 ACAGAGAAGCTGCATGGGGGTGG + Intronic
1025198464 7:56948764-56948786 TCCGAGAACGAGGAAGGGGCCGG + Intergenic
1025209955 7:57014626-57014648 TCAGAGAAGCAGGCAAGGCCTGG - Intergenic
1025634952 7:63313937-63313959 ACAGGAAAGCAGGCAGGGACAGG + Intergenic
1025647743 7:63434233-63434255 ACAGGAAAGCAGGCAGGGACAGG - Intergenic
1025661996 7:63562225-63562247 TCAGAGAAGCAGGCAAGGCCTGG + Intergenic
1025673487 7:63628169-63628191 TCCGAGAACGAGGAAGGGGCCGG - Intergenic
1026117764 7:67510636-67510658 CCAGAGCAGAAGGAAGAGGCGGG - Intergenic
1026529553 7:71185148-71185170 ACAGAGAGGAAGGAAGGGGAGGG - Intronic
1026900933 7:74037127-74037149 AAAAAGAAATAGGAAGGGGCCGG - Intronic
1026917838 7:74132857-74132879 AAAAAAAAGAAGGAAGGGGCCGG - Intergenic
1027050741 7:75019785-75019807 CCTGAGATGCAGGCAGGGGCCGG + Intronic
1027053371 7:75033311-75033333 ACAGAGAAGCAGGGAGGGACGGG + Intronic
1027358462 7:77383565-77383587 ACAGAGAAGGAGGAATGGGGTGG - Intronic
1028198519 7:87934488-87934510 ACAGAGCAGCAAGAAGGGCACGG - Exonic
1028752204 7:94394320-94394342 AGAGAAAAGCTGGACGGGGCTGG + Intergenic
1029073425 7:97918115-97918137 GCAGACAAGCAGGTAGGGGCTGG + Intergenic
1029402867 7:100356491-100356513 AGACAGAAGCAGGCAGGGACAGG - Intronic
1029405516 7:100372381-100372403 AGACAGAAGCAGGCAGGGACGGG - Intronic
1029443061 7:100598592-100598614 AGAGAGAGGCAGGAAGCGGCAGG + Intronic
1029590511 7:101503896-101503918 ACTGTGAAACAGGAAGTGGCAGG - Intronic
1029606135 7:101600585-101600607 ACACATAGGCAGGAAGTGGCAGG - Intergenic
1029949253 7:104565700-104565722 ACAGACAGACAGGAAGGTGCAGG - Intronic
1030165870 7:106554311-106554333 AAAGAGAAGCTGGTAGGGGGAGG + Intergenic
1030842222 7:114369474-114369496 CCAGAGAAACAAGAAGGTGCAGG - Intronic
1031072148 7:117173674-117173696 ACAGAGAGGGATGAAGGGGCTGG - Intronic
1031995527 7:128227898-128227920 CCAGAAGAGCAGGAAGGGGGAGG + Intergenic
1032199299 7:129808127-129808149 ATAGAGAAGAGGGAAGGGGAGGG - Intergenic
1032520332 7:132539026-132539048 ACAGGGAAACAGGCAGGGGCTGG - Intronic
1032657482 7:133947295-133947317 AAAGAGAAGCCTGAAGGGGCAGG - Intronic
1032902713 7:136328700-136328722 AGAGAGAAGAGGGAAGGGGCAGG + Intergenic
1033214590 7:139483967-139483989 ACAAAGAAGAGGGAAGGGTCAGG - Intergenic
1033656160 7:143376070-143376092 TCAGAGAAGCAGGAGAAGGCAGG - Intergenic
1033662679 7:143413235-143413257 ACAGACAAGAAGGAAAGGGAAGG - Intergenic
1033705982 7:143885262-143885284 ACAGAGATGTGGGAAGGCGCTGG + Intronic
1034357745 7:150466036-150466058 ACAGAGAAGCATGATGTGGTGGG - Intronic
1034572751 7:151970188-151970210 AAGGGAAAGCAGGAAGGGGCGGG + Intronic
1034621662 7:152461849-152461871 AGAGAGAAGAGGGAAGGGGAGGG + Intergenic
1034836763 7:154359436-154359458 ACACAGCAGAAGGCAGGGGCTGG - Intronic
1035339580 7:158151648-158151670 AGAGGGAAGAAGGAGGGGGCGGG - Intronic
1035720496 8:1787899-1787921 AAAAGGAGGCAGGAAGGGGCGGG - Intergenic
1035731650 8:1857712-1857734 ACAGAGAAGAAACAAGAGGCTGG - Intronic
1036051594 8:5205461-5205483 AAAGAGAGGAAGGAAGGGCCGGG + Intergenic
1036244267 8:7103175-7103197 GCAGACAAGCACGTAGGGGCTGG - Intergenic
1036361008 8:8076928-8076950 GCAGACAAGCAGGTAGGGGCTGG - Intergenic
1036743795 8:11389968-11389990 AGAGAGAAGCAGGGATGGGTGGG + Intergenic
1036889956 8:12590073-12590095 GCAGACAAGCAGGTAGGGGCTGG + Intergenic
1036897569 8:12648234-12648256 GCAGACAAGCAGGTAGGGGCTGG + Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037586555 8:20280678-20280700 GCAGGGAGGGAGGAAGGGGCAGG + Intronic
1037636516 8:20705254-20705276 AAAGGGATGCAGGAAGGGACAGG + Intergenic
1037661932 8:20935257-20935279 ACAGAGAGGAAGGCAGGGGTGGG - Intergenic
1038050676 8:23807582-23807604 AAAGAGAAGCAGGAAGGGTGAGG + Intergenic
1038346349 8:26735746-26735768 CCAGTGAAGCAGGCAAGGGCTGG + Intergenic
1038455184 8:27668173-27668195 AAAGAGGAGCTGGAAGGGGCTGG + Intronic
1038734226 8:30154925-30154947 AGAGAGAAGTAGGCAGGGGCTGG + Intronic
1039459193 8:37729172-37729194 AAAGAAAAGAAGGAAGGGGCAGG + Intergenic
1039472875 8:37825049-37825071 ACAGAGATACAGGGAGGGGGTGG + Intronic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039776067 8:40738047-40738069 AAAGAAAAGCAGGAAGGGACGGG + Intronic
1040075240 8:43222775-43222797 AATGAGAAGCAGTTAGGGGCTGG + Intergenic
1040384495 8:46905095-46905117 ACAGAGAACCAGCGAGGGGGAGG - Intergenic
1041242915 8:55863645-55863667 AAAGAGAAGAGGGAAGGGGAGGG + Intergenic
1041321246 8:56615145-56615167 AAAGAGAAAGAGGAAGGGGAAGG - Intergenic
1041494731 8:58472902-58472924 ACAGAGAGGCAGCACGTGGCAGG + Intergenic
1041601171 8:59718784-59718806 GCAGAGAAGGAGGAAGGGAAGGG + Intergenic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1041928719 8:63265048-63265070 ACAGAGAAGGGTGAAGGGGCAGG + Intergenic
1042403528 8:68377093-68377115 AGTAAGAAGCAAGAAGGGGCTGG + Intronic
1042791209 8:72608279-72608301 GCAGAGAGGCAGGCAGAGGCTGG + Intronic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1043740678 8:83807818-83807840 ACACAGAAACAGGAGGGGCCAGG + Intergenic
1044386268 8:91592203-91592225 ACAGTGGAGCAGGGAGGAGCTGG + Intergenic
1044514226 8:93120131-93120153 GAAGAGAGGCAGGCAGGGGCTGG - Intergenic
1044515081 8:93128184-93128206 ACACAGAAGAGGGAAGGGGATGG + Intergenic
1044751091 8:95416030-95416052 AAAGAGAAGAAAGAAGGGGGTGG - Intergenic
1045215640 8:100145872-100145894 GCAGAGCCGGAGGAAGGGGCGGG - Intergenic
1045356871 8:101397098-101397120 AAAGAGGACCAGGAAGGGGCAGG + Intergenic
1045554935 8:103206780-103206802 GGAGAGAAGCAGGATGGGGCAGG + Intronic
1045632033 8:104135660-104135682 ACAGAGAAGCAGCATGTGGTAGG + Intronic
1046752592 8:117941048-117941070 TGTGAGAAGCAGGATGGGGCAGG - Intronic
1046908195 8:119597022-119597044 ATTCAGATGCAGGAAGGGGCGGG + Intronic
1047107494 8:121749296-121749318 ACAAATAAGCAGGAGGGGGAAGG + Intergenic
1047261313 8:123263010-123263032 GAAGAGAAGCGGGAAGGGGAGGG + Intronic
1047500256 8:125435029-125435051 TCAGAGAAGCAGGCAGAGACAGG + Intronic
1047542692 8:125785570-125785592 ACACTGAAACAGGGAGGGGCAGG - Intergenic
1047665764 8:127089400-127089422 ACAGAGAAGCAGGAAAATGAGGG + Intergenic
1048080491 8:131121328-131121350 ACAGAGAAGCAGCAAGGTGTAGG + Intergenic
1048165926 8:132061380-132061402 AGAGAGAAGGAGGAAGGGAGAGG - Intronic
1048169397 8:132091003-132091025 ACAGAGAAGGAGGCCGAGGCGGG - Intronic
1048208875 8:132438391-132438413 AGATAGAAGGAGGAATGGGCAGG - Intronic
1048267877 8:133003777-133003799 GCAGAGGAGAAGGAAGGGTCTGG - Intronic
1048861837 8:138729545-138729567 AGAGAGAAGCTGGAAGCAGCTGG + Intronic
1049436542 8:142588722-142588744 ACATGGAACAAGGAAGGGGCAGG - Intergenic
1049623766 8:143611093-143611115 ACGGAGAAGCTGAACGGGGCTGG - Intergenic
1049649981 8:143761304-143761326 CCGGAGCAGCAGGCAGGGGCCGG - Intergenic
1049720704 8:144114210-144114232 ACAGGGGAGAAGGTAGGGGCTGG + Intronic
1050112818 9:2234403-2234425 CCTGAGAAGCAGGGAGAGGCGGG - Intergenic
1050431717 9:5569018-5569040 GCAGAGAGGCAGGAAGGTGTGGG + Intronic
1050568436 9:6912177-6912199 GCAGGAAAGGAGGAAGGGGCAGG - Intronic
1051068092 9:13129164-13129186 TCAGAAAAGCAGGATGAGGCTGG + Intronic
1051145404 9:14022069-14022091 ACAGAGATCCAGGCAGGGCCAGG - Intergenic
1051287484 9:15511231-15511253 GCAGAGAAGCCAGCAGGGGCGGG - Intergenic
1051353117 9:16216909-16216931 GCAGAGTAGCAGGAAGTAGCAGG - Intronic
1051756002 9:20401522-20401544 ACACAAAGACAGGAAGGGGCTGG - Intronic
1051823723 9:21195707-21195729 ACAGAAAAGCAGGGAGGAGAGGG + Intergenic
1052523001 9:29574040-29574062 ACAGAGAAGCAGGACATGTCAGG - Intergenic
1052871753 9:33514401-33514423 AATGAGAAGCAGTTAGGGGCTGG + Intergenic
1053242379 9:36506620-36506642 TAAGAGAAGAAGAAAGGGGCTGG - Intergenic
1053417412 9:37955415-37955437 ACAGAGGGGGAGGTAGGGGCAGG + Intronic
1053453245 9:38210955-38210977 ACACAGAGAAAGGAAGGGGCTGG + Intergenic
1053685960 9:40522953-40522975 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1053711377 9:40812986-40813008 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1053935913 9:43151226-43151248 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1054277775 9:63102016-63102038 ACAGAGACGCAGGGAGGAGATGG + Intergenic
1054299042 9:63358406-63358428 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1054397061 9:64662914-64662936 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1054421289 9:64933803-64933825 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1054431703 9:65168106-65168128 ACAGAGACGCAGGGAGGAGATGG - Intergenic
1054498675 9:65853401-65853423 ACAGAGACGCAGGGAGGAGATGG + Intergenic
1054735403 9:68745207-68745229 GGGGAGAAGCAGGGAGGGGCAGG + Intronic
1054746185 9:68856243-68856265 ATAGAGAAGCAGTAAGGTTCGGG - Intronic
1054824375 9:69557498-69557520 ACAGGGCAGCAGGAGGGAGCGGG - Intronic
1054866953 9:70012734-70012756 TCAGAGAAGGAGAAAGGGGGAGG - Intergenic
1055514025 9:77019498-77019520 AGAGAGAAGCAGAGAGGGCCTGG + Intergenic
1055576583 9:77666025-77666047 ACCAAGAAGAAGGAAGGGGAAGG - Intergenic
1055577614 9:77675977-77675999 GCAGAGAAGGAGTAAGGAGCAGG + Intergenic
1055604701 9:77956636-77956658 ACAGAGCCCCAGGAAGGGGGAGG + Intronic
1056502211 9:87221199-87221221 ACTGAGGAGCAGCAAGGGTCTGG - Intergenic
1056512828 9:87321869-87321891 ATGGAGTAGGAGGAAGGGGCTGG - Intergenic
1056515629 9:87346497-87346519 ACAAAGAGCCAGGAAGAGGCAGG - Intergenic
1056919400 9:90772742-90772764 ACTGAGAAGCAGGAAGGAGTAGG + Intergenic
1057270007 9:93645320-93645342 ACAGAGAGGCAGGAGGCGCCTGG - Intronic
1057302499 9:93894948-93894970 AGGGAGATGCAGGAAGGGGGCGG - Intergenic
1057307890 9:93922759-93922781 ACAGAGAAGAAGGAAGAGGGAGG + Intergenic
1057564634 9:96156889-96156911 GCAGAGGAGCAGGAAAGGGCTGG + Intergenic
1057685852 9:97233553-97233575 AATGAGAAGCAGTTAGGGGCTGG - Intergenic
1057713543 9:97468790-97468812 CCAGAGAACCAGGAATGGACTGG + Intronic
1057725985 9:97568514-97568536 ACAGGGAAGCAGAAAGGGAAGGG + Intronic
1057802538 9:98198876-98198898 TCAGGGAACCAGGCAGGGGCTGG + Intergenic
1059361118 9:113742722-113742744 CAACAGAAGCAGGAAGAGGCTGG - Intergenic
1059396249 9:114035776-114035798 ACAGAGAAGCAGGAGGAAGTGGG - Intronic
1059422247 9:114199494-114199516 ACAGGGAGGCAGGAAGGCCCAGG - Intronic
1059658539 9:116378604-116378626 ACAGAGACCCAGGCAGTGGCTGG + Intronic
1059825793 9:118027510-118027532 CCAGGGCAGAAGGAAGGGGCGGG - Intergenic
1060155726 9:121318629-121318651 GCAGAGGAGCAGGATGTGGCTGG - Intronic
1060454100 9:123774008-123774030 ACAGTGAAAGAGGAAGGGGAAGG + Intronic
1060727766 9:126017179-126017201 ACAGAGTGGCAGGTAGGGTCAGG + Intergenic
1060730385 9:126033439-126033461 GGGGAGATGCAGGAAGGGGCTGG - Intergenic
1060830263 9:126709346-126709368 CAGGAGAAGCAGGAAGGAGCAGG + Intergenic
1060834564 9:126745361-126745383 ACAGAGATGGAGCAAGGGCCTGG + Intergenic
1060995660 9:127873856-127873878 GCAGAGAACCAGAGAGGGGCAGG - Intronic
1061226752 9:129284892-129284914 GCAGAGAAGAGGGAAGGGGGTGG + Intergenic
1061297742 9:129686156-129686178 CCAGTGAAGCTGGAGGGGGCAGG + Intronic
1061456146 9:130699414-130699436 ACAGAAAAGCATCAAGAGGCTGG - Intronic
1061555271 9:131364224-131364246 ACAAAAGAGCAGGAAGAGGCCGG - Intergenic
1061571229 9:131478589-131478611 AGAGAGAAGAAAGAAGGAGCAGG + Exonic
1062376591 9:136264522-136264544 ACGGAGAAACAGGAAAAGGCAGG - Intergenic
1062527690 9:136984955-136984977 AGAGAGGGGCAGGGAGGGGCCGG - Exonic
1062694660 9:137867267-137867289 ACAGACCAACGGGAAGGGGCAGG - Intronic
1203779193 EBV:91494-91516 CCAAAGAGGCAGGCAGGGGCCGG + Intergenic
1185575920 X:1172171-1172193 AGAGAGAAACAGAACGGGGCAGG - Intergenic
1185683832 X:1910717-1910739 ACAGAGAAGGAGGAAGAGAGAGG - Intergenic
1185683931 X:1911366-1911388 ACAGAGAAGGAGGAAGAGAGAGG - Intergenic
1186076748 X:5887801-5887823 ACACAGAAGCAAGGAGAGGCAGG - Intronic
1186174077 X:6906880-6906902 GCCAAGAAGCAGGAAGGAGCTGG - Intergenic
1186488676 X:9953968-9953990 ACTGAGTAACAGGAAGAGGCTGG - Intergenic
1186600284 X:11029421-11029443 ACAAAGAAGCAGGATTTGGCAGG - Intergenic
1186637177 X:11419075-11419097 ACAGAGAAGCAGGGATAGACTGG - Intronic
1186852086 X:13590607-13590629 AGAGAGAAGGAGGTTGGGGCAGG - Intronic
1187059174 X:15769545-15769567 TCAGGGAAGCAGGATGGAGCAGG - Intronic
1187069781 X:15877145-15877167 ATGGAGAAGTTGGAAGGGGCAGG + Intergenic
1187179858 X:16934123-16934145 TGAGGGAAGCAGGATGGGGCTGG + Intergenic
1187470384 X:19564570-19564592 AGAGAGAAAGAGGAAGGGGGGGG - Intronic
1187896927 X:23990769-23990791 AGAGAGGAGAAGGAAGGGGGGGG - Intronic
1188002973 X:24999318-24999340 AGAGAGAAGAAAGAGGGGGCGGG - Intergenic
1189208121 X:39259310-39259332 GCTGAGAAGAAGGAAGGGGGAGG - Intergenic
1189245841 X:39562705-39562727 AGAGAGAAGGAGGAAGTGCCAGG + Intergenic
1189773808 X:44452121-44452143 ACTGAGATGCAGGAAGGGTGAGG + Intergenic
1190491883 X:50990618-50990640 GCAGAGAGGGAGGCAGGGGCTGG - Intergenic
1190501279 X:51081062-51081084 GCAGAGAGGGAGGCAGGGGCTGG + Intergenic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1190731574 X:53229963-53229985 ACAGAGTAACAGGGAGTGGCTGG + Intergenic
1190871397 X:54427488-54427510 ACAGAGAGAGAGGTAGGGGCAGG - Intergenic
1190879398 X:54482344-54482366 CCAGAGAAGCAGGGAGGAGGTGG - Intronic
1191007513 X:55726018-55726040 AGAGGGAAGCAGGAAGTGGGTGG + Intronic
1191218955 X:57965309-57965331 ACAGAGAAAAAGGAACGGGAAGG + Intergenic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1191842558 X:65523655-65523677 AGTGGGAAGCAAGAAGGGGCTGG - Exonic
1193487808 X:82108097-82108119 ACAGACAAAGAGGAAGAGGCTGG - Intergenic
1194277860 X:91909336-91909358 ACAGAGGATCAGGAAGGAGAGGG - Intronic
1194721627 X:97346982-97347004 ACAGAGAAGGAAGAAGGTGATGG - Intronic
1195322023 X:103728159-103728181 CCAGAGAAGAAGGAAGGAGAGGG + Exonic
1195559074 X:106262744-106262766 ACAGAGAAAGAGGAAAGGGAAGG + Intergenic
1196157965 X:112451854-112451876 ACAGAGAAGTAGGGATGGGGAGG - Intergenic
1196329515 X:114454264-114454286 ATAGAGAAGCAAGATAGGGCAGG + Intergenic
1197005998 X:121499119-121499141 AAAGAGCAGCAGGAAGGGATTGG + Intergenic
1197171915 X:123444147-123444169 ACAAAGAAGGAGGGAGGGGGAGG - Intronic
1197665284 X:129216634-129216656 ACAGGGTAGCAGGAAGGAGAAGG + Intergenic
1197830081 X:130632345-130632367 AGAATGTAGCAGGAAGGGGCGGG + Intronic
1197854041 X:130895697-130895719 ACAGAGCACCAGAAAGGGGAGGG + Intronic
1199553553 X:149081537-149081559 AAAGACAATCAGGTAGGGGCAGG - Intergenic
1200267943 X:154655890-154655912 ACAGAGGCGCAGGAGGAGGCCGG - Intergenic
1200374282 X:155763287-155763309 ACTGAGAAGTTGGAAGGGGGAGG - Intergenic
1200595195 Y:5131410-5131432 ACAGAGGATCAGGAAGGAGAGGG - Intronic
1201522903 Y:14896332-14896354 ACAGAGAAGGAGGAAGAACCTGG + Intergenic