ID: 900440253

View in Genome Browser
Species Human (GRCh38)
Location 1:2651397-2651419
Sequence GGATTGTCACAAGTTCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 1, 2: 2, 3: 1, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900440253_900440256 1 Left 900440253 1:2651397-2651419 CCCAGGTGAACTTGTGACAATCC 0: 1
1: 1
2: 2
3: 1
4: 148
Right 900440256 1:2651421-2651443 AAACACAACCCCACACACGCAGG 0: 1
1: 0
2: 1
3: 27
4: 381
900440253_900440260 21 Left 900440253 1:2651397-2651419 CCCAGGTGAACTTGTGACAATCC 0: 1
1: 1
2: 2
3: 1
4: 148
Right 900440260 1:2651441-2651463 AGGTAAGCATCTGACAGCCAAGG 0: 1
1: 0
2: 9
3: 50
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900440253 Original CRISPR GGATTGTCACAAGTTCACCT GGG (reversed) Intronic
900439805 1:2648841-2648863 GGATTGTCGCAAGTTCACCTGGG - Intronic
900439880 1:2649208-2649230 AGATTGTCACAAGCTCACCTGGG - Intronic
900440081 1:2650463-2650485 AGATTGTCACAAGCTCACCTGGG - Intronic
900440253 1:2651397-2651419 GGATTGTCACAAGTTCACCTGGG - Intronic
901321492 1:8343036-8343058 GGAGTCTGACAAGTTCAGCTGGG + Intronic
912903671 1:113680446-113680468 GGATTTTCATAAGTAAACCTGGG - Intronic
913010390 1:114677545-114677567 GGATTCCCACAAGTTCCTCTGGG + Intronic
913943604 1:125135091-125135113 GGTTTGTCACAAATTCCCATTGG + Intergenic
913955609 1:143288657-143288679 GGTTTGTCACAAATTCTCATTGG - Intergenic
913981823 1:143526784-143526806 GGTTTGTCACAAATTCTCATTGG + Intergenic
914076187 1:144353440-144353462 GGTTTGTCACAAATTCTCATTGG + Intergenic
914102991 1:144613056-144613078 GGTTTGTCACAAATTCTCATTGG - Intergenic
915611652 1:156998304-156998326 GTATTGGCACAAGCTCACATCGG + Intronic
915946159 1:160153164-160153186 GGATGATCACAAATTAACCTTGG + Exonic
924183458 1:241462888-241462910 GGATTATCACAGGGACACCTGGG + Intergenic
1064819539 10:19310497-19310519 GGATTGTCAGAAGTCCAATTAGG + Intronic
1066779136 10:38924067-38924089 GGTTTGTCACAAATTCTCATTGG + Intergenic
1066952090 10:42129557-42129579 GGTTTGTCACAAATTCTCATTGG - Intergenic
1070336809 10:75463255-75463277 GCATTTTCACAAGTTCCCCGGGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1076606600 10:131693590-131693612 GGACTGTAACAAGTTCATCATGG - Intergenic
1085570659 11:77555431-77555453 GGAATGTCACAAGATCAGTTAGG - Intronic
1086811377 11:91314625-91314647 GGATTGACACCAGTTCTTCTGGG + Intergenic
1087581278 11:100058261-100058283 GGATTCTCACAAAGTTACCTGGG - Intronic
1098403189 12:70095520-70095542 GGATTGCTAAAAGTTCAGCTGGG - Intergenic
1098970350 12:76848293-76848315 AGATTGCCACGTGTTCACCTTGG + Exonic
1102870141 12:116407845-116407867 GGGGTCTCACAAGTTTACCTAGG + Intergenic
1103190917 12:119001327-119001349 AGCTTGTCACAAGGTCCCCTGGG + Intronic
1104327297 12:127811447-127811469 AGGTTGACACCAGTTCACCTAGG + Intergenic
1104365678 12:128174391-128174413 AGAATGTCCCAGGTTCACCTAGG - Intergenic
1104374658 12:128253470-128253492 GAATTGTCACATGTTGACTTTGG - Intergenic
1104759726 12:131289665-131289687 GGATTGGCCCAAGGTCACCCGGG - Intergenic
1104820989 12:131677548-131677570 GGATTGGCCCAAGGTCACCCGGG + Intergenic
1105232849 13:18515627-18515649 GGTTTGTCACAAATTCTCATTGG + Intergenic
1105386314 13:19932695-19932717 GGATCTTCACATGTTCACATGGG - Intergenic
1114312487 14:21479620-21479642 GGAGTCTCACTCGTTCACCTAGG - Intronic
1121264956 14:92595597-92595619 GGCTTTGCACAAGCTCACCTTGG - Intronic
1122036683 14:98954125-98954147 GGATTTGCCCAAGGTCACCTGGG + Intergenic
1122082836 14:99278461-99278483 GCTTTGTCACAAGTTCAAATGGG - Intergenic
1202938120 14_KI270725v1_random:112185-112207 GGTTTGTCACAAATTCTCATTGG - Intergenic
1124609558 15:31199164-31199186 GGATTGTCACTAGTTCTTATAGG - Intergenic
1127461181 15:59200591-59200613 GGGGTGTCACAATGTCACCTAGG - Intronic
1136701177 16:32144133-32144155 GGTTTGTCACAAATTCTCATTGG + Intergenic
1136766483 16:32783329-32783351 GGTTTGTCACAAATTCTCATTGG - Intergenic
1136801615 16:33087049-33087071 GGTTTGTCACAAATTCTCATTGG + Intergenic
1136936300 16:34468924-34468946 GGTTTGTCACAAATTCTCATTGG - Intergenic
1136940338 16:34518764-34518786 GGTTTGTCACAAATTCTCATTGG - Intergenic
1136945432 16:34645027-34645049 GGTTTGTCACAAATTCTCATTGG + Intergenic
1136948359 16:34684174-34684196 GGTTTGTCACAAATTCTCATTGG + Intergenic
1136955756 16:34784048-34784070 GGTTTGTCACAAATTCTCATTGG + Intergenic
1136959482 16:34829806-34829828 GGTTTGTCACAAATTCTCATTGG + Intergenic
1136963520 16:34879646-34879668 GGTTTGTCACAAATTCTCATTGG + Intergenic
1137088150 16:36154932-36154954 GGTTTGTCACAAATTCTCATTGG + Intergenic
1137092661 16:36214133-36214155 GGCTTGTCACAAATTCTCATTGG + Intergenic
1137220538 16:46445433-46445455 GGTTTGTCACAAATTCTCATTGG - Intergenic
1138565148 16:57827676-57827698 GGATGGTCACAAATTTCCCTGGG + Intronic
1139075473 16:63441947-63441969 GGAGTCTCACACGGTCACCTAGG + Intergenic
1203068872 16_KI270728v1_random:1045579-1045601 GGTTTGTCACAAATTCTCATTGG - Intergenic
1144188636 17:12822405-12822427 GGATTGTCACTGGTTGCCCTTGG + Intronic
1145691701 17:26748107-26748129 GGTTTGTCACAAATTCTCATTGG + Intergenic
1145708435 17:26944745-26944767 GGTTTGTCACAAATTCTCATTGG + Intergenic
1152416151 17:80163511-80163533 GGCTTGTGCCAAGTTCACTTTGG + Intergenic
1203183216 17_KI270729v1_random:85654-85676 GGTTTGTCACAAATTCTCATTGG + Intergenic
1154165034 18:12008454-12008476 GGACTGTCCCAAGTTCACTAAGG - Intronic
1154520452 18:15222825-15222847 GGTTTGTCACAAATTCTCATTGG - Intergenic
1155134167 18:22971669-22971691 GGAGTCTCACACTTTCACCTAGG + Intronic
1162882765 19:13672349-13672371 GGTTTGCCTCCAGTTCACCTTGG - Intergenic
1164078292 19:21840698-21840720 CGAGTGTCACAATGTCACCTGGG + Intronic
1164233684 19:23313619-23313641 AGAGTGTCACAATCTCACCTGGG - Intronic
1164303494 19:23982745-23982767 AGAGTGTCACAATCTCACCTGGG + Intergenic
1164325809 19:24190488-24190510 AGAGTGTCACAATCTCACCTGGG + Intergenic
1165301726 19:34974018-34974040 GGATTGTTAAAAGTTTCCCTGGG + Intergenic
1167467486 19:49658019-49658041 GGATTTTCTCAAGGCCACCTGGG + Intronic
1202671330 1_KI270709v1_random:56199-56221 GGTTTGTCACAAATTCTCATTGG + Intergenic
1202681687 1_KI270712v1_random:10966-10988 GGTTTGTCACAAATTCTCATTGG + Intergenic
926624613 2:15080791-15080813 GGATAGTCACACTTCCACCTGGG + Intergenic
934250079 2:90344086-90344108 GGTTTGTCACAAATTCTCATTGG - Intergenic
934259488 2:91459330-91459352 GGTTTGTCACAAATTCTCATTGG + Intergenic
934302785 2:91791251-91791273 GGTTTGTCACAAATTCTCATTGG + Intergenic
934330472 2:92061515-92061537 GGTTTGTCACAAATTCTCATTGG - Intergenic
934468696 2:94291401-94291423 GGTTTGTCACAAATTCTCATTGG - Intergenic
938519805 2:132056597-132056619 GGTTTGTCACAAATTCTCATTGG - Intergenic
939027917 2:137035672-137035694 GGATTTTCACCAGTCTACCTGGG - Intronic
939819397 2:146937895-146937917 GTGTTGTCACAAGTTCAACAAGG + Intergenic
940661918 2:156556826-156556848 GAAGTGGCACAAGTTCATCTAGG + Intronic
944143421 2:196481246-196481268 GGAATGTCACAATTTTAGCTTGG + Intronic
945193707 2:207217715-207217737 GGGTTGTCACAAGGTGATCTGGG + Intergenic
947428720 2:230007099-230007121 GGACTGAGACAAGTTCACCAAGG + Intronic
948174256 2:235930765-235930787 GGAATGTCACTAGTGCATCTGGG + Exonic
949057951 2:241939379-241939401 GGGCTGTAAGAAGTTCACCTGGG - Intergenic
1176014077 20:62919762-62919784 GGATTGTTGCAAGCTCACATGGG - Intronic
1176585195 21:8576951-8576973 GGTTTGTCACAAATTCTCATTGG + Intergenic
1176776829 21:13143929-13143951 GGTTTGTCACAAATTCTCATTGG + Intergenic
1177488680 21:21792568-21792590 GCATTCTAACAAGGTCACCTAGG - Intergenic
1180268003 22:10553851-10553873 GGTTTGTCACAAATTCTCATTGG + Intergenic
1182682810 22:32095548-32095570 GGATTGTGACATTTTCCCCTTGG + Intronic
1203290726 22_KI270735v1_random:35776-35798 GGTTTGTCACAAATTCTCATTGG - Intergenic
954847455 3:53572239-53572261 GGATGGTGTCAAGTCCACCTAGG + Intronic
955598714 3:60621172-60621194 GGAGTCTCACATGGTCACCTAGG + Intronic
963715865 3:148803060-148803082 AGACTGTCACAAGTTGGCCTTGG - Intronic
965484547 3:169262652-169262674 GGAGTGTCACAAGAAAACCTGGG + Intronic
970837196 4:20423611-20423633 TGATTCTCACAATTTCACATGGG + Intronic
974920505 4:68233403-68233425 GGATTGTTAAAAGTCCAGCTAGG - Intronic
975259406 4:72278904-72278926 GGATTGTTAACAATTCACCTGGG - Intergenic
980033698 4:127859730-127859752 GGATTGATACCAGTTCTCCTTGG - Intergenic
981823284 4:148911004-148911026 GTATTGTCATAAGTTAACCTAGG + Intergenic
982160793 4:152567437-152567459 GTATTGTCACTAGTCAACCTGGG - Intergenic
982301763 4:153886000-153886022 AGACTGTCACAAGGTCAGCTGGG + Intergenic
986181808 5:5400058-5400080 GGATTGTCTTAGGTTCATCTTGG + Intergenic
986984252 5:13482109-13482131 GGAGAGTGATAAGTTCACCTTGG - Intergenic
992303316 5:75407674-75407696 GGCCTGTGACAAGTTCACTTTGG - Intronic
996859773 5:128051797-128051819 GAATTATCAGATGTTCACCTTGG - Intergenic
1004080807 6:12390883-12390905 GGATTGACAGAAATTCAACTTGG + Intergenic
1010919139 6:81659610-81659632 GGATTTTTACAACATCACCTGGG + Intronic
1013570332 6:111417385-111417407 GCATTGTCCCTAGTTCCCCTTGG + Intronic
1023960533 7:44922327-44922349 GGATTGCCACAAGTTCTCACTGG - Intergenic
1024805912 7:53139540-53139562 GGTTTGTCACAAATTCTCATTGG - Intergenic
1025473993 7:60896725-60896747 GGTTTGTCACAAATTCTCATTGG + Intergenic
1025480158 7:60972880-60972902 GGTTTGTCACAAATTCTCATTGG + Intergenic
1025488768 7:61084966-61084988 GGTTTGTCACAAATTCTCATTGG - Intergenic
1025513011 7:61593149-61593171 GGTTTGTCACAAATTCTCATTGG - Intergenic
1025551811 7:62259476-62259498 GGTTTGTCACAAATTCTCATTGG - Intergenic
1025557565 7:62328197-62328219 GGTTTGTCACAAATTCTCATTGG - Intergenic
1025565061 7:62424206-62424228 GGTTTGTCACAAATTCTCATTGG + Intergenic
1033600735 7:142886687-142886709 GGTTTGTTACGAGTTTACCTGGG - Intergenic
1034493484 7:151406793-151406815 GGATTGACACCAGTTCACAGAGG - Intronic
1036939147 8:13034329-13034351 GAGTTCTCACAAGGTCACCTAGG + Intergenic
1041963370 8:63646480-63646502 GCATTGTCACATTTTCAGCTGGG + Intergenic
1043584606 8:81753759-81753781 GGATAGTCAGCAGTTGACCTGGG - Intronic
1047320816 8:123780753-123780775 GGATTGTTAGAAATTTACCTTGG - Intronic
1049786899 8:144455413-144455435 GGATTTTCACACCTTCTCCTGGG - Intronic
1052630233 9:31028406-31028428 GTAATGCCACAAGTTCAGCTCGG - Intergenic
1053699087 9:40669433-40669455 GGTTTGTCACAAATTCTCATTGG - Intergenic
1053945097 9:43299677-43299699 GGTTTGTCACAAATTCTCATTGG - Intergenic
1054310376 9:63468834-63468856 GGTTTGTCACAAATTCTCATTGG - Intergenic
1054409165 9:64792984-64793006 GGTTTGTCACAAATTCTCATTGG - Intergenic
1054442328 9:65276801-65276823 GGTTTGTCACAAATTCTCATTGG - Intergenic
1054487953 9:65744695-65744717 GGTTTGTCACAAATTCTCATTGG + Intergenic
1056559288 9:87716274-87716296 GAATTGTGAAAAGTTCACCATGG + Intergenic
1057704091 9:97385694-97385716 GGAGTGTCTCATGTTCTCCTGGG + Intergenic
1060149084 9:121276046-121276068 GGATTTTCACAAGATCCCCATGG + Intronic
1062107380 9:134763331-134763353 GGAGAGTCACAAGATCCCCTGGG - Intronic
1203581071 Un_KI270746v1:5462-5484 GGTTTGTCACAAATTCTCATTGG + Intergenic
1203588232 Un_KI270747v1:28255-28277 GGTTTGTCACAAATTCTCATTGG - Intergenic
1203615098 Un_KI270749v1:54469-54491 GGTTTGTCACAAATTCTCATTGG + Intergenic
1192600641 X:72460160-72460182 GGAGTGTCACACTGTCACCTAGG + Intronic
1194874589 X:99171205-99171227 TGATGGTCACAGGTTCAGCTTGG - Intergenic
1194933995 X:99925373-99925395 GGATTGTATCAAGTTGACCAAGG + Intergenic
1195336635 X:103861249-103861271 GGATAGTCACAAGGCCTCCTTGG - Intergenic
1196369565 X:114961640-114961662 GGAGTGGAACAAGATCACCTTGG - Intergenic
1200000577 X:153057801-153057823 GGCTTTACACAACTTCACCTGGG - Exonic
1200327629 X:155259216-155259238 GGATTGTAGCCAGTTCAGCTAGG - Exonic
1200862894 Y:8011855-8011877 TGATGGTCACAATCTCACCTCGG + Intergenic