ID: 900447472

View in Genome Browser
Species Human (GRCh38)
Location 1:2688544-2688566
Sequence GGGTGCTGCTCCGTGGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900447472_900447480 7 Left 900447472 1:2688544-2688566 CCTGAACCCACGGAGCAGCACCC 0: 2
1: 0
2: 0
3: 11
4: 155
Right 900447480 1:2688574-2688596 CCGGCGCGCATCCGACAGCCTGG 0: 1
1: 6
2: 27
3: 232
4: 534
900447472_900447483 28 Left 900447472 1:2688544-2688566 CCTGAACCCACGGAGCAGCACCC 0: 2
1: 0
2: 0
3: 11
4: 155
Right 900447483 1:2688595-2688617 GGAGCAGCACCCACACCCCCAGG 0: 142
1: 367
2: 417
3: 318
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900447472 Original CRISPR GGGTGCTGCTCCGTGGGTTC AGG (reversed) Intronic
900163777 1:1236699-1236721 GGGGCCTGCTCCCTGGTTTCAGG + Intergenic
900350693 1:2233188-2233210 GGGTCCTGCTCCGAGGGGGCCGG + Intronic
900350737 1:2233303-2233325 GGGTCCTGCTCCGAGGGGGCCGG + Intronic
900447472 1:2688544-2688566 GGGTGCTGCTCCGTGGGTTCAGG - Intronic
900450324 1:2746324-2746346 GGGTGCTGCTCCGTGGGTTCAGG - Intronic
901104169 1:6742404-6742426 GGGTGCTGCCAAGTGGGTTTGGG - Intergenic
901842171 1:11960634-11960656 TGGTGCTGCTCCTGGGGTTGGGG - Exonic
903404138 1:23082246-23082268 GCGTGCTGATCCCTGGGCTCGGG + Exonic
904253126 1:29238380-29238402 CGGGGCTGCTCCGCGGGCTCCGG + Intronic
905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG + Exonic
906580718 1:46933487-46933509 AGGTGCAACTCCCTGGGTTCTGG - Intronic
906797850 1:48711806-48711828 GGGTGCTGCTTCTGGGGTCCAGG - Intronic
907415561 1:54311675-54311697 GGCTGCTGCTCAGTGTGGTCAGG - Intronic
911061074 1:93748306-93748328 GGGTGCTGGTCAGTGGGGTATGG - Intronic
912446776 1:109742341-109742363 CGGAGCTGCTCTGAGGGTTCTGG + Intronic
912964662 1:114227257-114227279 AGTAGGTGCTCCGTGGGTTCTGG + Intergenic
914921813 1:151852501-151852523 GGGGGCTGCTGCCTGGGCTCGGG + Intronic
920017712 1:202927096-202927118 CGGTGCGGCTGTGTGGGTTCGGG - Exonic
921113906 1:212068296-212068318 GAGTGCTGCTACCTGGGTACAGG - Exonic
923539618 1:234878511-234878533 GGGGGCTGCTCCGTGGCCTTGGG - Intergenic
1067187342 10:44042387-44042409 GGATGCTGCCCTGTGGGATCTGG - Intergenic
1068168066 10:53357193-53357215 AGGTGCAGCTCAGAGGGTTCTGG + Intergenic
1074401033 10:113141345-113141367 GAGTGCTGGTCCTGGGGTTCTGG + Intronic
1076202849 10:128572022-128572044 GAGTGATGCTCCGTTGGTTTGGG - Intergenic
1076802851 10:132839456-132839478 GGGTGCTGTTCCGTGTGTGTGGG - Intronic
1076831472 10:132996511-132996533 GGGTGGGTCTCCGTGGGGTCAGG - Intergenic
1076831499 10:132996588-132996610 GGGTGGGTCTCCGTGGGGTCAGG - Intergenic
1077331721 11:1986929-1986951 GGGGGCTGCTCAGGGGGTGCAGG + Intergenic
1077571418 11:3341465-3341487 GGCCTCTGCTCTGTGGGTTCTGG - Intronic
1077730022 11:4720708-4720730 GGGAGCTGCTCTTTTGGTTCTGG + Intronic
1079069608 11:17332617-17332639 GGGTGTGGCTCCTTGTGTTCTGG + Intronic
1081777608 11:45686301-45686323 AGGTGCTGAGCCTTGGGTTCGGG + Intergenic
1083635135 11:64116822-64116844 GGATGCTGCTCAGGTGGTTCCGG - Exonic
1086424948 11:86673756-86673778 GGGTGCTCCTGCCTGAGTTCAGG + Intergenic
1202814702 11_KI270721v1_random:42105-42127 GGGGGCTGCTCAGGGGGTGCAGG + Intergenic
1091651157 12:2311076-2311098 GGGTGATGCCCTGTGGATTCCGG - Intronic
1102543163 12:113636947-113636969 CAGTGCTGGTCTGTGGGTTCTGG - Intergenic
1102858421 12:116314845-116314867 GGGGGCCGCTCGGTGGGCTCTGG + Intergenic
1103592833 12:122004426-122004448 CGGGGCTGCTCTGTGGTTTCTGG - Intergenic
1112368346 13:98774138-98774160 GGGTGCGCCACCGTGGGTGCAGG + Intergenic
1119322458 14:73739920-73739942 GGGGGCTGCTCCTTGGGAGCTGG + Exonic
1119650343 14:76378611-76378633 GGCTGCTGCCCAGTGGGTCCTGG - Intronic
1122119427 14:99544080-99544102 GGGTTGTGCTCCGTGTGTGCTGG - Intronic
1122296535 14:100709231-100709253 GAGAGCGGCTCCGTGGGCTCTGG + Intergenic
1122815499 14:104310154-104310176 GGGTGCAGCTCCCTGGGGCCTGG - Intergenic
1123072236 14:105647514-105647536 GGGTGAGGCTCCGTGCGTTCAGG - Intergenic
1123092241 14:105747031-105747053 GGCTGAGGCTCCGTGCGTTCAGG - Intergenic
1123097817 14:105774732-105774754 GGCTGAGGCTCCGTGCGTTCAGG - Intergenic
1124477513 15:30047596-30047618 GGGTGCTGCTCCTTGGCTCTTGG + Intergenic
1125199492 15:37089074-37089096 TGTTGCTGCTGCGTGGTTTCTGG - Intronic
1127333146 15:57958018-57958040 AGGTGCTTCTCTGTGGGTCCTGG + Intronic
1128456543 15:67834642-67834664 GGGAGCCGCCCCGCGGGTTCTGG + Intergenic
1133756663 16:8767269-8767291 GGCAGCTGCGCCTTGGGTTCAGG - Intronic
1133760875 16:8797561-8797583 GGGTGATGCTCTTTGGGGTCGGG - Intronic
1136341185 16:29644599-29644621 GGGTCCTGCTTCGCGTGTTCTGG - Intergenic
1136908951 16:34130135-34130157 GAGTGCTGGTCAGTGGGTGCAGG - Intergenic
1137460011 16:48651741-48651763 GGGTGCTGGTCTGTGGCTCCGGG + Intergenic
1138683834 16:58707224-58707246 GCGTGCTGCTAGCTGGGTTCAGG - Exonic
1141593959 16:85086358-85086380 GCGTGGTGCTCCGTGCCTTCAGG + Intronic
1142884409 17:2903831-2903853 TGGTCCTGCTCCGTGGGCTCAGG + Intronic
1146377220 17:32302893-32302915 GTGTTCTGCTCCATGGGTTAGGG + Intronic
1146762044 17:35487455-35487477 GGGGGGTGGTCCGTGGGCTCCGG - Intronic
1147321255 17:39647417-39647439 GGGTGCTGCTCCCAGGGGGCTGG + Intronic
1147662157 17:42122511-42122533 GGGTGCGGCTCCCTCGGGTCTGG + Exonic
1148755967 17:49973096-49973118 GGGCGCCGCTCGGAGGGTTCCGG - Exonic
1149625556 17:58077976-58077998 GGCTGCTGCTCCCTGGAGTCAGG + Intergenic
1150619905 17:66800289-66800311 GAGTGCTGCTGTGTGGCTTCTGG - Intronic
1151383745 17:73742846-73742868 GGGTCCTGCTCCGTGGAAACAGG - Intergenic
1155353652 18:24930091-24930113 GTGTGCTGCTCTGTGGGCTCAGG - Intergenic
1160746469 19:713474-713496 GGGTGGTGCTCAGAGGGTCCAGG - Intronic
1161581131 19:5081653-5081675 GGGTGCTGATCTGTGGTGTCAGG + Intronic
1161818973 19:6517229-6517251 GGGTGGTCCTCTGTGGGTACAGG + Intergenic
1162284438 19:9727654-9727676 GGGTGGTGCTCCGTGGAGACTGG + Intergenic
1162760581 19:12886078-12886100 AGGGGCGGCTCCGTGGGGTCAGG + Exonic
1165480412 19:36060171-36060193 GGGTGCTGTTCCGTGTGCTGGGG + Intronic
929959875 2:46488351-46488373 GGGCTCTGCTCTGTGGGATCTGG - Intergenic
932308033 2:70717599-70717621 GGGAGCTGATCCGTGGGGCCGGG - Intronic
934612567 2:95752047-95752069 AGCTGCTGCTCCCTGGGCTCTGG + Intergenic
934648347 2:96072376-96072398 AGCTGCTGCTCCCTGGGCTCAGG - Intergenic
934841580 2:97627397-97627419 AGCTGCTGCTCCCTGGGCTCAGG - Intergenic
936045998 2:109188388-109188410 GGCTGCTGCTCAGCGGGGTCTGG + Intronic
942325321 2:174771666-174771688 GGGTGCAGCTCCCTGGGGCCTGG + Intergenic
947349210 2:229225289-229225311 CGGTGCTTCTCTGTGGGTACAGG - Intronic
948008505 2:234631575-234631597 GGGCTCTGCTCCTTGGGTTCTGG - Intergenic
948912159 2:241010163-241010185 GGGTGCTGCTTCCTGGCTCCTGG + Intronic
1169473701 20:5911390-5911412 GGGTGCTGCTTCGTGACGTCAGG + Intergenic
1169539344 20:6582213-6582235 AGGTGCTGCTCCGTGCAATCTGG - Intergenic
1171269591 20:23803458-23803480 GGGTGCTGGCACGTGGCTTCGGG - Intergenic
1171772079 20:29330605-29330627 GAGTGCTGGTCAGTGGGTGCAGG + Intergenic
1171904419 20:30888888-30888910 GAGTGCTGATCAGTGGGTGCAGG - Intergenic
1173572253 20:44085068-44085090 GGGTGATGCTCCGTCAGTTCTGG - Intergenic
1174890815 20:54390050-54390072 GGGCGCTGCTCAGCGGGTTTTGG - Intergenic
1175350718 20:58316005-58316027 GGGTGCTGCTTGGTGTGTGCTGG - Intronic
1175913707 20:62416101-62416123 GGGTGCTGCTCGGGGGGTGCTGG + Intronic
1176034975 20:63031746-63031768 GGGTGCTGGTCGTTGGGTCCAGG + Intergenic
1176047853 20:63101973-63101995 GGCTGCTGCTCCGCGGGCTCTGG + Intergenic
1177116268 21:17090648-17090670 GGGTGCAGGTCAGTGGGTGCAGG + Intergenic
1179729150 21:43357912-43357934 GGGAGCTGCCCCGAGGGTCCTGG - Intergenic
1179971112 21:44837055-44837077 GGGGGCTGCACCCTGGGTGCCGG - Intergenic
1180232351 21:46434696-46434718 GGCTGCTGCTCCTTGAGGTCTGG + Intronic
1180337840 22:11595029-11595051 GAGTGCTGGTCAGTGGGTGCAGG - Intergenic
1181584267 22:23844610-23844632 AGCTGCTGCTATGTGGGTTCCGG - Intergenic
1182145140 22:27992904-27992926 GGGTGGTGCTGCCTGGGTCCTGG - Intronic
1184198280 22:42946871-42946893 GGGAGCTGGGCCGTGGGTCCGGG + Intronic
1184292831 22:43507311-43507333 GGATGCTGCACCCAGGGTTCAGG - Exonic
1184770841 22:46595624-46595646 GGGTGACGCTCAGAGGGTTCAGG - Intronic
1185049404 22:48545985-48546007 GGGAGCTGCTCCGGAGGCTCTGG + Intronic
1185069536 22:48648432-48648454 GCCTGCTGCTACGTGGGTGCTGG + Intronic
1185251502 22:49804098-49804120 CGGTGCTGCCCCCTGGGCTCAGG - Intronic
950335156 3:12187510-12187532 GGGTGCATCTCCGTGGGTGGTGG - Exonic
950493121 3:13318194-13318216 GCGTGCTCCTCCCTGGGTTTTGG - Intronic
950556929 3:13701612-13701634 AGGTGCTCCTCCTTGAGTTCAGG + Intergenic
953098939 3:39807481-39807503 GGGCTCAGCTCCCTGGGTTCTGG - Intergenic
954036651 3:47854492-47854514 GGCTGCTGCTGCTCGGGTTCAGG - Intronic
956164520 3:66386272-66386294 GGGTGATGATCTGTGGCTTCAGG + Exonic
957886659 3:86297155-86297177 GGGTGCTGGACAGTGGGTGCAGG + Intergenic
961336061 3:126180398-126180420 GGCTGCAGCTCCGGGGGCTCCGG - Intronic
961449707 3:126997041-126997063 GTGTGCTGCTATGTGGGCTCTGG + Intronic
963706735 3:148697842-148697864 CGTTGCTGCTTCTTGGGTTCCGG - Exonic
964738968 3:159945596-159945618 GGCTGTTACTCAGTGGGTTCAGG - Intergenic
967971617 3:195003702-195003724 GGGTGCTGCTGCGGGGGCTGGGG - Intergenic
975256131 4:72236876-72236898 GAGTGCTGGTCAGTGGGTGCAGG - Intergenic
978491597 4:109316499-109316521 TGGTGCTACTCCGAGGATTCTGG + Intergenic
979084936 4:116396235-116396257 GAGTGCTGATCCGTAGGGTCAGG + Intergenic
983217655 4:165017053-165017075 GGGTGTTGCTCCTGAGGTTCTGG - Intergenic
985669789 5:1201387-1201409 GGAGGCTGCTCCGTGGGCGCTGG - Intergenic
997055572 5:130439115-130439137 GGGTTCTGTTCCTTGGGATCTGG + Intergenic
998012920 5:138709597-138709619 GGGTGCTGCTGGGTGGGCTGGGG + Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1002781949 6:373764-373786 GGCCCCTGCTCCGTGGGGTCCGG + Intergenic
1002782055 6:374490-374512 GGCCCCTGCTCCGTGGGGTCCGG + Intergenic
1003992384 6:11498893-11498915 GTTTGATGTTCCGTGGGTTCAGG + Intergenic
1006578052 6:35060283-35060305 GGGTGCTGCTCAGTGGAAACAGG + Intronic
1006665293 6:35688935-35688957 GGGCGCTGCCCCGGGGATTCGGG - Intronic
1007625432 6:43243742-43243764 GGGGGCTCCTTCGTGGGCTCAGG + Intronic
1013255563 6:108380937-108380959 GCATTCTCCTCCGTGGGTTCTGG + Intronic
1018871635 6:167788357-167788379 GGGCGTTCCTCCGTGGCTTCGGG - Intronic
1019294559 7:266971-266993 GGCTGCTGCTGTGTGGGGTCTGG + Intergenic
1019442418 7:1054117-1054139 GCGGGCTGCTCCGTGGGCTCTGG - Intronic
1019596887 7:1862215-1862237 GGGTGCTGCTCGGTGTGCTGAGG - Intronic
1020895444 7:13933476-13933498 GGCTCCTGCACAGTGGGTTCAGG + Intronic
1023292822 7:38686011-38686033 TGGGGCTGCTCCGTGGGTCCGGG + Exonic
1025869215 7:65415148-65415170 GAGTGCGGCTCTGTGGGTGCAGG - Intergenic
1026300055 7:69089924-69089946 GGGGGCTGCTTCTGGGGTTCTGG - Intergenic
1026710029 7:72729666-72729688 GGGAGCTGGTCCTTGGGCTCTGG - Intronic
1029209966 7:98899340-98899362 GGGTGATGCTCAGTGGGCACTGG + Intronic
1034552974 7:151832878-151832900 GGGTCCTGCAACGTGGGGTCAGG - Intronic
1035739915 8:1919207-1919229 TGGAGCTGCTCCGTGGGTGATGG + Intronic
1040104845 8:43535750-43535772 GGGTCCTGGTCAGTGGGTTCTGG + Intergenic
1042800486 8:72712796-72712818 GAGTGCTGGGCAGTGGGTTCAGG + Intronic
1049253517 8:141601939-141601961 GGCTGCTGCTCCCTGCCTTCGGG + Intergenic
1049426023 8:142538234-142538256 GGGAGGTGCTCCCTGGGTCCCGG + Intronic
1049664027 8:143835242-143835264 GGGAACTGCTCCATGGGGTCTGG - Exonic
1050124898 9:2346829-2346851 GGATGCTGCTCCTTGCATTCTGG - Intergenic
1057354201 9:94321379-94321401 GGGAGCTGCTCCCAGAGTTCTGG + Intronic
1057653563 9:96936256-96936278 GGGAGCTGCTCCCAGAGTTCTGG - Intronic
1057724585 9:97559162-97559184 GTGAGCTGCTCCGTGGGAGCTGG + Intronic
1060428300 9:123525228-123525250 GAGGGCTGCTCCCTGGGTCCTGG - Intronic
1060636479 9:125203463-125203485 GGCAGCTGCTCTGTGGGTGCTGG + Intronic
1060811829 9:126614577-126614599 GGGTGCTGCTGGGTGAGTGCGGG + Exonic
1062111411 9:134784053-134784075 GGGTCCTGTTCCCTGGGCTCAGG - Intronic
1062152781 9:135030439-135030461 GGGTGCTGCGGGGTGGGCTCAGG + Intergenic
1062393949 9:136345138-136345160 GGGTGCTGCCCTGAGGGGTCCGG + Intronic
1185469295 X:373307-373329 GGGTGCTGCTCTGTGGGAAGCGG - Intronic
1186992890 X:15088529-15088551 GAGTGCTGCACAGTGGGTGCAGG + Intergenic
1187048878 X:15676117-15676139 GCTTGCTGCTCCTTGGTTTCTGG - Intergenic
1193058952 X:77184587-77184609 GAGTGCTGCACAGTGGGTGCAGG + Intergenic
1200024826 X:153249052-153249074 TAGTGCTTCTCCCTGGGTTCTGG - Intergenic