ID: 900447655

View in Genome Browser
Species Human (GRCh38)
Location 1:2689450-2689472
Sequence CCGATGCTCACCTGGAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1445
Summary {0: 8, 1: 42, 2: 317, 3: 544, 4: 534}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900447655_900447660 7 Left 900447655 1:2689450-2689472 CCTCACCTCCAGGTGAGCATCGG 0: 8
1: 42
2: 317
3: 544
4: 534
Right 900447660 1:2689480-2689502 GGAGCAGCGCCCACACCCCCAGG 0: 40
1: 181
2: 365
3: 431
4: 509
900447655_900447667 26 Left 900447655 1:2689450-2689472 CCTCACCTCCAGGTGAGCATCGG 0: 8
1: 42
2: 317
3: 544
4: 534
Right 900447667 1:2689499-2689521 CAGGCGAGCATCTGACAGCCTGG 0: 106
1: 411
2: 547
3: 339
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900447655 Original CRISPR CCGATGCTCACCTGGAGGTG AGG (reversed) Intronic