ID: 900447657 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:2689455-2689477 |
| Sequence | ACTCTCCGATGCTCACCTGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 883 | |||
| Summary | {0: 2, 1: 0, 2: 18, 3: 319, 4: 544} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 900447657_900447660 | 2 | Left | 900447657 | 1:2689455-2689477 | CCTCCAGGTGAGCATCGGAGAGT | 0: 2 1: 0 2: 18 3: 319 4: 544 |
||
| Right | 900447660 | 1:2689480-2689502 | GGAGCAGCGCCCACACCCCCAGG | 0: 40 1: 181 2: 365 3: 431 4: 509 |
||||
| 900447657_900447667 | 21 | Left | 900447657 | 1:2689455-2689477 | CCTCCAGGTGAGCATCGGAGAGT | 0: 2 1: 0 2: 18 3: 319 4: 544 |
||
| Right | 900447667 | 1:2689499-2689521 | CAGGCGAGCATCTGACAGCCTGG | 0: 106 1: 411 2: 547 3: 339 4: 348 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 900447657 | Original CRISPR | ACTCTCCGATGCTCACCTGG AGG (reversed) | Intronic | ||