ID: 900447658

View in Genome Browser
Species Human (GRCh38)
Location 1:2689458-2689480
Sequence CAGACTCTCCGATGCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1042
Summary {0: 2, 1: 0, 2: 37, 3: 389, 4: 614}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900447658_900447667 18 Left 900447658 1:2689458-2689480 CCAGGTGAGCATCGGAGAGTCTG 0: 2
1: 0
2: 37
3: 389
4: 614
Right 900447667 1:2689499-2689521 CAGGCGAGCATCTGACAGCCTGG 0: 106
1: 411
2: 547
3: 339
4: 348
900447658_900447660 -1 Left 900447658 1:2689458-2689480 CCAGGTGAGCATCGGAGAGTCTG 0: 2
1: 0
2: 37
3: 389
4: 614
Right 900447660 1:2689480-2689502 GGAGCAGCGCCCACACCCCCAGG 0: 40
1: 181
2: 365
3: 431
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900447658 Original CRISPR CAGACTCTCCGATGCTCACC TGG (reversed) Intronic