ID: 900447660

View in Genome Browser
Species Human (GRCh38)
Location 1:2689480-2689502
Sequence GGAGCAGCGCCCACACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1526
Summary {0: 40, 1: 181, 2: 365, 3: 431, 4: 509}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900447658_900447660 -1 Left 900447658 1:2689458-2689480 CCAGGTGAGCATCGGAGAGTCTG 0: 2
1: 0
2: 37
3: 389
4: 614
Right 900447660 1:2689480-2689502 GGAGCAGCGCCCACACCCCCAGG 0: 40
1: 181
2: 365
3: 431
4: 509
900447655_900447660 7 Left 900447655 1:2689450-2689472 CCTCACCTCCAGGTGAGCATCGG 0: 8
1: 42
2: 317
3: 544
4: 534
Right 900447660 1:2689480-2689502 GGAGCAGCGCCCACACCCCCAGG 0: 40
1: 181
2: 365
3: 431
4: 509
900447653_900447660 23 Left 900447653 1:2689434-2689456 CCGCATGGAATGGCATCCTCACC 0: 14
1: 12
2: 9
3: 12
4: 128
Right 900447660 1:2689480-2689502 GGAGCAGCGCCCACACCCCCAGG 0: 40
1: 181
2: 365
3: 431
4: 509
900447657_900447660 2 Left 900447657 1:2689455-2689477 CCTCCAGGTGAGCATCGGAGAGT 0: 2
1: 0
2: 18
3: 319
4: 544
Right 900447660 1:2689480-2689502 GGAGCAGCGCCCACACCCCCAGG 0: 40
1: 181
2: 365
3: 431
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900447660 Original CRISPR GGAGCAGCGCCCACACCCCC AGG Intronic