ID: 900447667

View in Genome Browser
Species Human (GRCh38)
Location 1:2689499-2689521
Sequence CAGGCGAGCATCTGACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1751
Summary {0: 106, 1: 411, 2: 547, 3: 339, 4: 348}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900447658_900447667 18 Left 900447658 1:2689458-2689480 CCAGGTGAGCATCGGAGAGTCTG 0: 2
1: 0
2: 37
3: 389
4: 614
Right 900447667 1:2689499-2689521 CAGGCGAGCATCTGACAGCCTGG 0: 106
1: 411
2: 547
3: 339
4: 348
900447655_900447667 26 Left 900447655 1:2689450-2689472 CCTCACCTCCAGGTGAGCATCGG 0: 8
1: 42
2: 317
3: 544
4: 534
Right 900447667 1:2689499-2689521 CAGGCGAGCATCTGACAGCCTGG 0: 106
1: 411
2: 547
3: 339
4: 348
900447657_900447667 21 Left 900447657 1:2689455-2689477 CCTCCAGGTGAGCATCGGAGAGT 0: 2
1: 0
2: 18
3: 319
4: 544
Right 900447667 1:2689499-2689521 CAGGCGAGCATCTGACAGCCTGG 0: 106
1: 411
2: 547
3: 339
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900447667 Original CRISPR CAGGCGAGCATCTGACAGCC TGG Intronic