ID: 900457157

View in Genome Browser
Species Human (GRCh38)
Location 1:2782759-2782781
Sequence CCTCCTCTGTAAAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 908
Summary {0: 1, 1: 0, 2: 17, 3: 173, 4: 717}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900457157_900457166 -4 Left 900457157 1:2782759-2782781 CCCTCCTCCTTTTACAGAGGAGG 0: 1
1: 0
2: 17
3: 173
4: 717
Right 900457166 1:2782778-2782800 GAGGAAACTGAGGCCTGGGGAGG 0: 2
1: 50
2: 306
3: 1428
4: 4786
900457157_900457165 -7 Left 900457157 1:2782759-2782781 CCCTCCTCCTTTTACAGAGGAGG 0: 1
1: 0
2: 17
3: 173
4: 717
Right 900457165 1:2782775-2782797 GAGGAGGAAACTGAGGCCTGGGG 0: 1
1: 15
2: 163
3: 617
4: 2187
900457157_900457169 15 Left 900457157 1:2782759-2782781 CCCTCCTCCTTTTACAGAGGAGG 0: 1
1: 0
2: 17
3: 173
4: 717
Right 900457169 1:2782797-2782819 GAGGTGAAGTGATTCGGCTGCGG 0: 1
1: 1
2: 1
3: 27
4: 282
900457157_900457163 -9 Left 900457157 1:2782759-2782781 CCCTCCTCCTTTTACAGAGGAGG 0: 1
1: 0
2: 17
3: 173
4: 717
Right 900457163 1:2782773-2782795 CAGAGGAGGAAACTGAGGCCTGG 0: 4
1: 110
2: 483
3: 1506
4: 3208
900457157_900457168 9 Left 900457157 1:2782759-2782781 CCCTCCTCCTTTTACAGAGGAGG 0: 1
1: 0
2: 17
3: 173
4: 717
Right 900457168 1:2782791-2782813 CCTGGGGAGGTGAAGTGATTCGG 0: 1
1: 0
2: 1
3: 32
4: 273
900457157_900457170 27 Left 900457157 1:2782759-2782781 CCCTCCTCCTTTTACAGAGGAGG 0: 1
1: 0
2: 17
3: 173
4: 717
Right 900457170 1:2782809-2782831 TTCGGCTGCGGTTGCTTAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 41
900457157_900457164 -8 Left 900457157 1:2782759-2782781 CCCTCCTCCTTTTACAGAGGAGG 0: 1
1: 0
2: 17
3: 173
4: 717
Right 900457164 1:2782774-2782796 AGAGGAGGAAACTGAGGCCTGGG 0: 2
1: 51
2: 364
3: 1297
4: 3337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900457157 Original CRISPR CCTCCTCTGTAAAAGGAGGA GGG (reversed) Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900457602 1:2785124-2785146 CCTCCTCTCCCAAAGGGGGATGG - Intronic
900620855 1:3586985-3587007 CCACCTGTGTGCAAGGAGGAAGG + Intronic
900883218 1:5397238-5397260 CCTTCCCTGTATAAGTAGGATGG + Intergenic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901645853 1:10716349-10716371 CTTCCTCTGGAAATGGAGGCAGG - Intronic
901714009 1:11138649-11138671 CCTCCTTCTTAAAAGGAAGAGGG - Intronic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902700218 1:18167348-18167370 CCTCCTCTGTACAATAAGGCCGG - Intronic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903185137 1:21624618-21624640 CCTCTCCTGTCAAAGGAGGATGG + Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903230363 1:21918621-21918643 CCTCCTCTATAGAATGAGGGTGG - Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903624240 1:24719912-24719934 CCTCATCTGTAAAATAACGATGG - Intergenic
903659669 1:24969458-24969480 CCTCCTCTGAAAAGTGAGGAGGG - Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
903993631 1:27290784-27290806 CCTCATCTGTAAAAGGAAAGAGG - Intronic
904007334 1:27370310-27370332 CCTCCTCTATAAAATGGGCAGGG - Intronic
904203616 1:28838001-28838023 CCTCCTCTGTACACTGAGGATGG + Intronic
904388471 1:30163152-30163174 CCTCCTTTGGAAAACGGGGATGG - Intergenic
904399518 1:30246984-30247006 CCTTCTCTGTAAAACTAGGATGG + Intergenic
904901723 1:33862848-33862870 CATCTTCTGTAAAAGAAAGATGG - Exonic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905967842 1:42114255-42114277 CCTTGTCTGTAAAAGGCCGAGGG + Intergenic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906730811 1:48079571-48079593 CCTCATCTGTAAAACGATGGTGG - Intergenic
906960335 1:50416089-50416111 CCTCCTCTGTAAAATGGGGCCGG + Intergenic
907257350 1:53190045-53190067 CCTTATCTGTAAAAGGGAGATGG - Intergenic
907305110 1:53508987-53509009 CCCCCTCTGTAAAGTGGGGATGG + Intronic
907343420 1:53753903-53753925 CCTCCTCAGTGAGAAGAGGAGGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907572992 1:55501057-55501079 ACTCCTCTGTAATAGGAATAGGG + Intergenic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907822308 1:57982785-57982807 CATCCTCTATGAAAGGATGAGGG - Intronic
908001480 1:59684503-59684525 CCTCCTCTGAAAGCGGAAGAAGG + Intronic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909833140 1:80219364-80219386 CCTTGTCTGTAAAACGAGGTAGG + Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912227372 1:107750082-107750104 CCTCCTCAATAAAATGAAGATGG - Intronic
912488524 1:110048123-110048145 CCTCCTCTGTAAAATGAATGGGG + Intronic
913243683 1:116852592-116852614 CCTCTTCAGTAAAAGAAGCACGG - Intergenic
913329305 1:117654001-117654023 CCTCCTCTGTAGTAGGAAGTAGG + Intergenic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
913371654 1:118106326-118106348 TCTCCTCCGTAAAATGAAGATGG - Intronic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
914858756 1:151370153-151370175 CATCCTCTGTAAAATGGAGATGG + Intronic
915471549 1:156128732-156128754 CCTCATCTATAAAAGGGAGAGGG + Intronic
916312510 1:163412614-163412636 CCAACTCTGGACAAGGAGGAAGG + Intergenic
916470621 1:165119035-165119057 CCAGCTCTCTAAAAGGAAGATGG - Intergenic
916513196 1:165491638-165491660 CTTCCTCTGTAAATGGAATATGG + Intergenic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
916969470 1:169996223-169996245 GATCCTCTGTTAAAGCAGGAAGG - Intronic
917623858 1:176826025-176826047 CCTCATCAGTAAAACAAGGATGG - Intronic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
917904304 1:179574350-179574372 CCTCATCTGTGATAAGAGGATGG + Intronic
918220489 1:182432207-182432229 CCTCCACTATAAAATGAGGACGG - Intergenic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
918655140 1:187016097-187016119 CCTCATCTCTAAAATGAGAATGG + Intergenic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921951007 1:220929945-220929967 CTACCTCTGTAAAAGAAGAAAGG - Intergenic
922534302 1:226368473-226368495 CCTGCTCTTTAACAGGAAGATGG - Intronic
922824807 1:228510418-228510440 CCTCCTCCCTGAAAGGAGGAAGG - Intergenic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923325043 1:232873499-232873521 CCTGTTCAGTAAGAGGAGGATGG + Intergenic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923674336 1:236066603-236066625 CCTTCTCTGTAAAACAGGGAAGG - Intergenic
923955222 1:239010124-239010146 CCTGATCTATAATAGGAGGAAGG - Intergenic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924441134 1:244086405-244086427 GCATCTCTGTAAGAGGAGGAAGG - Intergenic
924456971 1:244226698-244226720 CTTCCTTTTTAAAAGAAGGAAGG + Intergenic
1063371796 10:5527019-5527041 CCTCGTTTGTAAGATGAGGAAGG - Intergenic
1063570825 10:7213278-7213300 CCTACTGTGTATTAGGAGGAAGG + Intronic
1064131369 10:12712942-12712964 CACCCTCTGTGAAAGGAGGGAGG + Intronic
1064751819 10:18538101-18538123 CCACCTCCATAAGAGGAGGAAGG - Intronic
1064893349 10:20205789-20205811 CCTCATCTGTAAGATGAGGTGGG - Intronic
1065865214 10:29909124-29909146 CCTCCTGTGCAAAATGAGCAAGG + Intergenic
1065963057 10:30749977-30749999 CCTCACCTGTAAAAAGAAGAAGG - Intergenic
1067080762 10:43211041-43211063 CCTCCTCTGTTCAGGCAGGAAGG + Intronic
1067185708 10:44025344-44025366 GCCCCTCTGTAGAATGAGGATGG + Intergenic
1068870379 10:61937065-61937087 CCTCATCAGTAAAATGAGAAAGG + Intronic
1069532484 10:69229565-69229587 CCTTGTCTGTATCAGGAGGAGGG - Intronic
1069702716 10:70438451-70438473 CCCTCTCTGTAAAAGGGAGATGG + Intronic
1069741926 10:70690372-70690394 TCTCCTCTGCAAAGGGTGGAAGG - Intronic
1069855952 10:71441126-71441148 TCTCCTCTGTAAAATGAGCTGGG - Intronic
1069971564 10:72174816-72174838 CCTCCTCTGTAAAATAAGGGAGG + Intronic
1070361693 10:75696651-75696673 CCTCATCTGTAAAAGTGAGAGGG - Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070742217 10:78910656-78910678 CCTCCTCTGTGAGATGGGGATGG + Intergenic
1071223791 10:83501488-83501510 CATCCTGTCTAAACGGAGGAGGG - Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1072900159 10:99400068-99400090 CCTTCTCTGAAAAAGTAGAAAGG - Intronic
1073044893 10:100631146-100631168 CCTCATCTGTAAAACAGGGATGG + Intergenic
1073069765 10:100785923-100785945 TCTCCTCTGTAAAATGAAGATGG + Intronic
1073189131 10:101637754-101637776 CCTTATCTCTAAAAGGAGGAGGG - Intronic
1073207847 10:101778123-101778145 CCTACTGTGTACAAGGATGAGGG - Intronic
1073295417 10:102435670-102435692 GCTCTTCTGAGAAAGGAGGAAGG - Intergenic
1073426850 10:103460146-103460168 CCATCTCTGTAAAATGGGGATGG - Intergenic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074109007 10:110409365-110409387 CCTCCTCTCTAAAGGGAGTAAGG + Intergenic
1074526194 10:114265478-114265500 CCTCCTCTGTAAAATAAGGGAGG - Intronic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074662951 10:115682990-115683012 CATCTTCTGTAAAAGGGGGATGG + Intronic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1075372568 10:121950357-121950379 TTTCCTCTGTAAAGGCAGGAAGG + Intergenic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1076439574 10:130471860-130471882 TCACCTCCGTAAAAGCAGGAGGG + Intergenic
1078332957 11:10441025-10441047 ACTCCCCTGAAGAAGGAGGAGGG + Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078545055 11:12241145-12241167 CCTCCTCTGAAAAGGCAGGTAGG + Exonic
1078557573 11:12342729-12342751 CCTCCTGTGGAAAATGGGGATGG - Intronic
1078761863 11:14258114-14258136 GCTCTTCAGTAAAAGAAGGAGGG - Intronic
1078779126 11:14420577-14420599 CCTCATCTGTAGAACAAGGATGG + Intergenic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1080036337 11:27715791-27715813 CCTCATCTGTAAAAGGTGATTGG + Intronic
1080692353 11:34568810-34568832 CCTCCCCTGTAAAATGGGCAGGG + Intergenic
1080873898 11:36259764-36259786 CCTCCCCTGATAAAGGAGGGAGG - Intergenic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081800381 11:45854833-45854855 CCTCATCTATAAAATAAGGATGG + Intronic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082226682 11:49715940-49715962 CCTCCTCTATATAATGAGGATGG - Intergenic
1082730960 11:56797024-56797046 CCTGCTCTATGAAATGAGGAGGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083448857 11:62728870-62728892 GCTCAGCTGTACAAGGAGGAAGG + Exonic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083767286 11:64847674-64847696 CCTTGTCTGTAAAAGGGGGTTGG + Intergenic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1085067479 11:73510555-73510577 CTTCCTCTGTAAAATGAGCAGGG + Intronic
1085260793 11:75203593-75203615 CCTCATCTATAAAAGGAGGGGGG - Intronic
1085477883 11:76799196-76799218 CCTCCTCTGCAAAACGGGGCAGG + Intergenic
1085516825 11:77116464-77116486 CCTCCTCTGTAAAATTAGTTGGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086337055 11:85810847-85810869 CCTCCTCTGTTAAGTGAGGGAGG - Intronic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1087049775 11:93874325-93874347 CCTCCTCTCTCAAAGAATGAAGG - Intergenic
1087156227 11:94907557-94907579 TCTTCTCTGTAAATGGAAGATGG - Intergenic
1087261286 11:96015349-96015371 CCTCATCTATAAAAGTAGTAAGG + Intronic
1088117118 11:106325094-106325116 TCTGCTCAGTAAAAGGAGGATGG - Intergenic
1088893264 11:114060461-114060483 CCTCCCCTGCAAAAGGGGGGTGG - Intronic
1089015038 11:115158633-115158655 CATCATCTGTAAAATGAGGCTGG - Intergenic
1089064037 11:115648842-115648864 CCTCGTCTGTGAACTGAGGAGGG - Intergenic
1089069271 11:115686931-115686953 CCTCCACTGGGATAGGAGGAAGG + Intergenic
1089601106 11:119615857-119615879 CCTCCTTGGTAAAATGAGTAAGG - Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1091446534 12:546876-546898 CCCCATCTGTGAAACGAGGACGG - Intronic
1091997188 12:5002861-5002883 CCTGCTCCGCAAAATGAGGAAGG - Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092477036 12:8828340-8828362 ACTCCTCTGTGAAAAGGGGAAGG - Intronic
1092831711 12:12450292-12450314 CTTCATCTGTAAAAGGAAGGAGG - Intronic
1093068074 12:14679612-14679634 CTTCCTTTTTGAAAGGAGGAGGG + Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1095038993 12:37422007-37422029 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1095049815 12:37545587-37545609 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096792471 12:54053610-54053632 CCTCCCCTGCAAAAGGAGATGGG - Intronic
1096802492 12:54120386-54120408 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1096815410 12:54198821-54198843 CCTCATCTATAAAACGGGGATGG - Intergenic
1098139337 12:67435730-67435752 CCTCCTCTACAAAACGATGATGG + Intergenic
1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG + Intergenic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1099388286 12:82046393-82046415 CCTCATCTGTAAGAGAAGTACGG + Intergenic
1100289953 12:93204240-93204262 CCTCATCTGTAAAACTAAGATGG + Intergenic
1100585257 12:95973417-95973439 CCTTATCTGTGAAATGAGGAAGG + Exonic
1100819429 12:98417543-98417565 CCTCCTCCCTAAAATGAGGCTGG + Intergenic
1100838291 12:98587906-98587928 CCTCCCCAGTCAAAGAAGGAAGG + Intergenic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101347798 12:103902516-103902538 CCTCCTCATTAACAAGAGGAAGG - Intergenic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102274564 12:111571072-111571094 CTTCCCCTGTAAAAAGGGGATGG - Intronic
1102735961 12:115159723-115159745 TCTCCTCTGTACAATGAAGATGG + Intergenic
1102776597 12:115524988-115525010 TCACCTCTGTAGAGGGAGGAGGG + Intergenic
1102854170 12:116278180-116278202 TCTCCTCTGCAAAAGGCGGACGG - Intergenic
1102912558 12:116728734-116728756 CTTCCTCTGTAAAATGGAGATGG - Intronic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1103413737 12:120730549-120730571 CCTCATCTGTAAGAGGAATATGG + Intronic
1103594270 12:122014127-122014149 TCTTTTCTGTAAAAGGAGGGAGG + Intergenic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1105600373 13:21881382-21881404 CCCCTTCTATAAGAGGAGGATGG + Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107902070 13:45026902-45026924 CCTCCTTTGTTAAATGAGAAAGG + Intronic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1110816643 13:79867678-79867700 CCTACTCAGTAAAAGGAGAATGG + Intergenic
1111578465 13:90190359-90190381 AACCCTCTGTCAAAGGAGGAAGG + Intergenic
1111649893 13:91076247-91076269 CCTTCTCTGTGAAATGTGGAAGG + Intergenic
1112355800 13:98674048-98674070 CCTCCACTGTCATAGGAGCAGGG - Intergenic
1113907675 13:113827521-113827543 CCTTATCTGTGAAACGAGGAGGG + Intronic
1114407453 14:22470149-22470171 ACTCCTCTGTGTAAAGAGGAAGG + Intergenic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114654591 14:24308488-24308510 CCTCCTCCGACCAAGGAGGAAGG - Exonic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1117187622 14:53257071-53257093 ACTCCTCTATCAAAGAAGGAAGG - Intergenic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1118909591 14:70050128-70050150 CCTCCTTTGTAAAAGGAGCAGGG + Intronic
1119522703 14:75297787-75297809 TCTCCTCTGTAAAAAAAGGCCGG + Intergenic
1119996950 14:79263587-79263609 TCTCCTCTGTAAAATGAGGGAGG + Intronic
1120030630 14:79636810-79636832 GCTCCTCTGCCAAAGGAGCATGG + Intronic
1120845668 14:89122811-89122833 CCTCCTCTGAAAAATGGGGGAGG - Intergenic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1121248468 14:92482164-92482186 CCTCATCTGTTAAATGAGAAAGG - Intronic
1121270343 14:92633419-92633441 CCTCCTCTGGGACAGGAGGGTGG - Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1121905028 14:97732025-97732047 TCTCTACTGTAAAAGGAAGACGG - Intergenic
1122094130 14:99358935-99358957 TCTTCTCTGTAAAGTGAGGAAGG - Intergenic
1122252764 14:100451650-100451672 GCTCTTCTGTAAAACAAGGATGG - Intronic
1122636837 14:103133976-103133998 CCTCCTCTGTGAAACGGGAATGG - Intronic
1122785789 14:104162778-104162800 CCTCCTCTGGAAATGGATGTGGG - Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124618756 15:31262101-31262123 TTTCCTCTGTAAAATGAGGTAGG + Intergenic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1125421051 15:39504420-39504442 CTTCCTCTGTAAAATGAGGCTGG - Intergenic
1125673972 15:41493158-41493180 CCTCCTCTGTTATAGGAGCTCGG - Intergenic
1127003691 15:54541113-54541135 CCTTCTCTGGATAAAGAGGAAGG - Intronic
1128078860 15:64844364-64844386 CCTCCTTTGTAAAAGGAAAAGGG + Intronic
1128086780 15:64892071-64892093 CCCTTTCTGTAAAAGCAGGAGGG - Intronic
1128674143 15:69596397-69596419 CCTCCTCTGTCAAAGGAAGGAGG - Intergenic
1128704213 15:69826969-69826991 CCTTCTCTGCAAAATTAGGAAGG - Intergenic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1128736731 15:70057845-70057867 CCTGCTCTGTAAAAAGAGGTGGG - Intronic
1128752716 15:70160727-70160749 TCCCCTCTGTAAAATGAGGGTGG + Intergenic
1128765339 15:70247920-70247942 CCTCACCTGTAAACAGAGGAGGG - Intergenic
1128793005 15:70446893-70446915 CCTCATCTGTAAAACAAGGATGG + Intergenic
1129208263 15:74050228-74050250 GCTCCTCTGTAGGAGGAAGATGG - Intergenic
1130094158 15:80843899-80843921 CTTCTTCTGTAAAACAAGGAGGG - Intronic
1130234930 15:82124937-82124959 CCTGCTCTTTGAAAGGAGGGAGG + Intergenic
1130911750 15:88275694-88275716 GCTCCTCTGAAAAATAAGGATGG + Intergenic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131469672 15:92685002-92685024 CCTCCCCTGTAAAATAAGGATGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131677273 15:94683318-94683340 CCTCCTCTGTAAAAAGGGGGTGG - Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132406319 15:101543561-101543583 CCTCAGCTGTAGAAGGACGAGGG - Intergenic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133427014 16:5701449-5701471 CATCCTTTGTACATGGAGGAAGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133499077 16:6348295-6348317 TCTCCTCTGTAAAAGAGAGATGG + Intronic
1133752334 16:8734533-8734555 CCTCCTCTGTAAAAAGACCATGG + Intronic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921675 16:10159129-10159151 CCTCCTCTCTACAATGAGGGTGG + Intronic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1134221852 16:12361110-12361132 CCTCCTCTGAGAAAGGACAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1135381643 16:22000935-22000957 CCTCCTCTGTAAAATGGCAACGG - Intronic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136112043 16:28069737-28069759 CCTCGTCTGTGAAATGAGGGCGG + Intergenic
1136237369 16:28923002-28923024 CTTCCTCTGTAAAATGGAGATGG + Intronic
1136295094 16:29297078-29297100 CCTCCTCTATAAGAGGGGGATGG + Intergenic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136556103 16:31008698-31008720 CCTGCTCTGCAAACTGAGGAGGG + Intronic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137563354 16:49517016-49517038 GCTCCTCTGTACAAGGAGGAAGG - Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137904019 16:52300607-52300629 CCTTCTCTATAAAATGAGGGAGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138537537 16:57667901-57667923 CCTCCTCTGTAAAGTGAAGATGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138855143 16:60681697-60681719 CCTCCTCTGTAAAATGAAGCAGG + Intergenic
1139658250 16:68402258-68402280 TCTCCTCTATAAAATGGGGAAGG + Intronic
1139851511 16:69953425-69953447 GCTCATCTGTAAACGGAGCAGGG - Intronic
1139880487 16:70176337-70176359 GCTCATCTGTAAACGGAGCAGGG - Intronic
1140372023 16:74419180-74419202 GCTCATCTGTAAACGGAGCAGGG + Intronic
1140526399 16:75626526-75626548 CCTGCTCTGTGAAAGGAGACTGG + Intergenic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1141220221 16:82062621-82062643 CCTCCTCTGTAAATGGGTGATGG + Intronic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141771637 16:86093208-86093230 CCTCCTCTCTACATAGAGGATGG - Intergenic
1141915077 16:87090259-87090281 CCTCCTCTTCAAAATGTGGATGG - Intronic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1142100995 16:88271087-88271109 CCTCCTCTATAAGAGGGGGATGG + Intergenic
1142236096 16:88923278-88923300 CCTCCTCTGTGCGATGAGGAGGG - Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1142830132 17:2542670-2542692 CCCCCTGTGAAAAAGGAGAAGGG + Intergenic
1142895187 17:2971664-2971686 CCTCATCTGTGAAATGATGATGG + Intronic
1143011826 17:3870208-3870230 CCTCCTCTGTCAAATGAGAGAGG - Intronic
1143065424 17:4243543-4243565 CCTCCTCTATAAAATGGGGCTGG - Intronic
1143368258 17:6422411-6422433 CCTCCTCTGCACTAGGAAGATGG + Intronic
1144326767 17:14190037-14190059 CCTCTTCTGAAATGGGAGGAAGG + Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144454959 17:15411370-15411392 CCTCCTCCTTAAAATGAGGAAGG + Intergenic
1144475648 17:15586901-15586923 CCTCTTCTGAAATGGGAGGAAGG + Intronic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144764888 17:17727253-17727275 CCTCTTCTGTCAAAGGAGGGAGG - Intronic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144769357 17:17750985-17751007 CCTCCTCTGTGGAAGGCGGAAGG - Intronic
1145271131 17:21405523-21405545 CTTCCTCTGAAAAACGAGGCTGG - Intronic
1145370433 17:22302673-22302695 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1145378932 17:22376527-22376549 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1145379410 17:22378897-22378919 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146000200 17:29126286-29126308 CCTCCCTTGTGAGAGGAGGAGGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146626990 17:34442480-34442502 CCTCCTCAGTGAAATGGGGATGG - Intergenic
1146957117 17:36942347-36942369 CCACCTCCGTAGAAGGAGAAGGG - Exonic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG + Intronic
1148118447 17:45192486-45192508 ACTCCTCAGTAAAAGAAAGAGGG - Intergenic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148741135 17:49893459-49893481 CCTCCTCTGTACAAGGTGCTGGG - Intergenic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148888640 17:50791749-50791771 CTTACTCCATAAAAGGAGGATGG - Intergenic
1149596875 17:57869378-57869400 CCTCCTCTGTAAAAATGGGGAGG + Intronic
1150233319 17:63571626-63571648 CCTTTTCTGAAAAATGAGGATGG + Intronic
1151271302 17:72998227-72998249 TATCCTCGTTAAAAGGAGGATGG - Intronic
1151271402 17:72999103-72999125 CATCCTCACCAAAAGGAGGATGG + Intronic
1151804183 17:76395583-76395605 CCGCCCCTGTAAAAGGTGGGTGG + Intronic
1151999409 17:77636194-77636216 CCTCTTCTGTAAAACGGGGGTGG - Intergenic
1152531360 17:80921323-80921345 CCTCATCTGTGTCAGGAGGATGG - Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1153097412 18:1423322-1423344 CCTTCTCTGTAAAATGGAGATGG + Intergenic
1153413380 18:4818745-4818767 TTTCCTCAGCAAAAGGAGGAAGG - Intergenic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1157075219 18:44458527-44458549 TCTCCTCTGTAAAAGGCAAAGGG + Intergenic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157198388 18:45638796-45638818 CCTCGTCTGTAACAAGAGGCTGG - Intronic
1157307082 18:46525199-46525221 CCTCCTCTGTGTAAGGGGGCTGG + Intronic
1157597664 18:48873684-48873706 CCCCATCTGTAAAAGAAGGATGG + Intergenic
1157948334 18:52006278-52006300 CATCCTCTCTAAATAGAGGAAGG + Intergenic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159327583 18:66943211-66943233 CCTCCTCTGTGCCACGAGGAAGG - Intergenic
1160159462 18:76460259-76460281 CCTCGTCTGTGAAATGAGGGTGG - Intronic
1160837935 19:1133258-1133280 CCTCCTCTGTGAGGGGAGGAAGG + Intronic
1161169195 19:2804634-2804656 CCTCATGTGTGAAGGGAGGAGGG - Intronic
1162144721 19:8606652-8606674 CCTCATCTATAAAAAGATGAGGG - Intronic
1162461906 19:10818418-10818440 CCTCATCTATCCAAGGAGGATGG - Intronic
1162686797 19:12393429-12393451 CCTCCTCTGTACATGTGGGATGG - Intronic
1162691149 19:12433203-12433225 CCTCCTCTGTACATGTGGGATGG - Intronic
1162719837 19:12655876-12655898 CCACCTCGGATAAAGGAGGAGGG + Exonic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1163753171 19:19090767-19090789 CCTCCCCTGTACCTGGAGGAGGG - Intronic
1164690316 19:30206097-30206119 CCTTCTCTATAAAATGGGGATGG - Intergenic
1165306581 19:35006395-35006417 CCTCCTCTGTAAAGCAGGGATGG + Intronic
1165387753 19:35521414-35521436 CCTCCTGTATAAAGGGAGGCAGG - Intergenic
1165394542 19:35557263-35557285 CCTCATCTGTAAGATGAGAATGG - Intronic
1165674806 19:37712944-37712966 TCTCCTCTGTGAATGGATGATGG + Intronic
1165952727 19:39483247-39483269 CCTCCCCAGTGGAAGGAGGAGGG - Intronic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166276004 19:41754495-41754517 CCTGATTTGTAAAAGGAGGATGG - Intronic
1166281255 19:41795539-41795561 CCTGATTTGTAAAAGGAGGATGG - Intergenic
1166412214 19:42563141-42563163 CCTGATTTGTAAAAGGAGGATGG + Intergenic
1166700671 19:44879725-44879747 CCTCCTCTGTAACACGGGGCAGG + Intronic
1166891874 19:45999051-45999073 CATCCTCTGTATAATGGGGATGG + Intronic
1167145181 19:47677080-47677102 CCTCGTCTGTGAAATGAGGAAGG + Intronic
1167346836 19:48951278-48951300 CCTTCTCTGTAACTGGAGTAGGG + Intergenic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167649313 19:50720727-50720749 CCCCCTCTGGAAAATGGGGATGG - Intergenic
1168111898 19:54197287-54197309 CTTCCTCTCTGAAAGGAGCACGG - Intergenic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
1168492289 19:56821160-56821182 CCTCATCTGTAAAATGAATATGG - Intronic
1168508146 19:56953500-56953522 CTTTCTCTGTAAAAGGAAAATGG + Intergenic
1168684811 19:58342192-58342214 CCTCCTCTATAAAACAGGGATGG - Exonic
925240134 2:2317947-2317969 GCTCCCCAGTCAAAGGAGGAAGG + Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925309229 2:2870465-2870487 CCCTCTGTGTAAAATGAGGAGGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926542034 2:14192937-14192959 TCACCTCTGTCAATGGAGGATGG + Intergenic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
926856301 2:17259880-17259902 CCTCCTTTTTAAAACAAGGAAGG + Intergenic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
927138531 2:20114448-20114470 CCGCCTCTGGAGAAGGATGATGG - Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
928752345 2:34485641-34485663 CATCCACTGTGAGAGGAGGAAGG - Intergenic
928904107 2:36353479-36353501 CCTCCTCTGCAAGAGTGGGAGGG + Intergenic
929192812 2:39155292-39155314 CCTCCTAAGTAAAAGGAGTCAGG + Intergenic
929420250 2:41783044-41783066 CCTTTTCTATAAAATGAGGAGGG - Intergenic
929693159 2:44091364-44091386 CTTCCCTTGTAAAACGAGGATGG - Intergenic
930494961 2:52129535-52129557 TCTCCTCTCTCAAAGAAGGAAGG + Intergenic
930517995 2:52432202-52432224 CCTCCTTGGTGAAAGGTGGAGGG - Intergenic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
931647758 2:64440628-64440650 CATCCTCTGGAAAATGAGCATGG - Intergenic
931859326 2:66337665-66337687 CCTTATCTGTAATATGAGGAGGG + Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932426801 2:71642933-71642955 CCTCCTCTGTATGAGAAGGTAGG - Intronic
932793091 2:74672739-74672761 CCTCCACTGTACTAGGAGGGAGG + Intronic
933094353 2:78159560-78159582 TCATCTCTGTAAAAGGAGTAGGG + Intergenic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933647243 2:84822683-84822705 ATTCCTCTGTCAATGGAGGATGG + Intronic
933708163 2:85306602-85306624 CAGCCTCTGCAAGAGGAGGAAGG + Intronic
933782254 2:85810912-85810934 CCTCATCTGTAAAACCAGGGCGG - Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
936410484 2:112254016-112254038 TCCCATCTGTAAAACGAGGACGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937156627 2:119724566-119724588 GATCCTCTGAAAAATGAGGATGG + Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937339286 2:121080742-121080764 CCTCCTCAGTGAAAGGGTGATGG - Intergenic
937850111 2:126624370-126624392 CCTCATCTGGAAAATAAGGATGG - Intergenic
937969229 2:127536562-127536584 CGTCCTCTGTGAAATGGGGATGG - Intronic
938231320 2:129662496-129662518 ATTCCTCTGTAAAAGGAGCCAGG + Intergenic
938242807 2:129756326-129756348 CCTCCACTGTAACAAAAGGAGGG + Intergenic
938951247 2:136256672-136256694 CCTCCTCTGTTAAAGGTTGAAGG + Intergenic
939620493 2:144413025-144413047 CCTCATCTGTAAAATGAGCCAGG + Intronic
940043178 2:149381421-149381443 CATCCTCTGTAACAGGAGGTAGG + Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941110585 2:161415910-161415932 CCTCCGCTCTAAAGGGGGGAAGG + Intergenic
941203510 2:162543743-162543765 CCTCATCTATAAAATAAGGAAGG + Intronic
942881392 2:180865435-180865457 CCTCCTCTGTAAAAAGCATATGG + Intergenic
943036884 2:182758168-182758190 ACTTCTCTGTAATAGTAGGAAGG - Intronic
943272515 2:185825312-185825334 CCTCATCTATAAAATGAGTATGG - Intronic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944804993 2:203272082-203272104 CCTTTTCTCTAAAAGGAGTAGGG - Intronic
944823028 2:203450515-203450537 ATTCTTCTATAAAAGGAGGAAGG + Intronic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945840529 2:214882319-214882341 CCTCTGCTGTCAAATGAGGAAGG - Intergenic
946413039 2:219525000-219525022 GCTCATCTGTAAAAGGGGAATGG - Intronic
946574969 2:221064784-221064806 ACACCTCTGAAACAGGAGGAGGG + Intergenic
946695098 2:222348813-222348835 GCTGCTCTGGAAAAGGAGGTGGG - Intergenic
947172239 2:227323346-227323368 CCCTCCCTGTATAAGGAGGAAGG + Intergenic
947441649 2:230127247-230127269 CCTGCCCTGGGAAAGGAGGATGG - Intergenic
947447119 2:230172599-230172621 ACTCCTGTCCAAAAGGAGGAGGG - Intronic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1168927061 20:1590527-1590549 CCTCGCCTGTAAAAGGAGGTAGG - Intronic
1169213727 20:3781989-3782011 CCTCCTTTGTGAAATGACGATGG + Intergenic
1169268079 20:4179746-4179768 CCTCTTCTGTAAAATGGGCATGG + Intronic
1170783397 20:19447272-19447294 CCTCCTCTGGCAAACGGGGAAGG + Intronic
1171523728 20:25794313-25794335 ACTGCTCTTTCAAAGGAGGAGGG - Intronic
1171524190 20:25796756-25796778 ACTGCTCTTTCAAAGGAGGAGGG - Intronic
1171531927 20:25858800-25858822 CCTGCTCTTTCAAAGGAGGAGGG - Intronic
1171532241 20:25860445-25860467 ACTGCTCTTTCAAAGGAGGAGGG - Intronic
1171532564 20:25862114-25862136 ACTGCTCTTTCAAAGGAGGAGGG - Intronic
1171533326 20:25866272-25866294 ACTGCTCTTTCAAAGGAGGAGGG - Intronic
1171544330 20:25989101-25989123 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171552637 20:26059127-26059149 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171553099 20:26061570-26061592 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171573536 20:26276632-26276654 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171806719 20:29687735-29687757 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171807031 20:29689347-29689369 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171837329 20:30168794-30168816 CCTGCTCTTTCAAAGGAGGAGGG - Intergenic
1171846617 20:30281288-30281310 ACTGCTCTTTCAAAGGAGGAAGG + Intergenic
1171847063 20:30283734-30283756 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1171847247 20:30284611-30284633 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1171854221 20:30330191-30330213 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1171902356 20:30869341-30869363 CCTCCTCTACAAAATAAGGATGG + Intergenic
1172126132 20:32626435-32626457 TCTCCTCTGTAAGATGGGGATGG - Intergenic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1172322184 20:34004162-34004184 CTTCCTTTGTACATGGAGGAGGG + Intronic
1172840384 20:37899512-37899534 CTCCATCTGTAAAAGAAGGAAGG + Intergenic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173628328 20:44490383-44490405 TCTCCTCTATAAAATGAGGCTGG + Exonic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173836594 20:46130081-46130103 CCACCTCTGTAAAAGAGGGAGGG - Intergenic
1174052435 20:47776382-47776404 CCTCCTTTGTAAAACGGGGTTGG + Intronic
1174297908 20:49562038-49562060 CCTCCTCTGTAAAATGGGCCTGG - Intronic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1175169297 20:57068813-57068835 CCCTATCTGTAAATGGAGGAGGG + Intergenic
1175624968 20:60482406-60482428 GCTCATCTGTAAGAGGTGGACGG - Intergenic
1176075570 20:63246839-63246861 CCGCCTCTGTAAAATGCAGATGG - Intronic
1176679481 21:9811725-9811747 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176679769 21:9813133-9813155 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176680051 21:9814542-9814564 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176680904 21:9818765-9818787 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176681472 21:9821591-9821613 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176682034 21:9824409-9824431 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176682315 21:9825810-9825832 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176682595 21:9827219-9827241 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176682874 21:9828638-9828660 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176683153 21:9830035-9830057 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176683432 21:9831445-9831467 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176683713 21:9832854-9832876 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176683991 21:9834257-9834279 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1176684270 21:9835666-9835688 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1177918100 21:27116047-27116069 CCTCTTCTATAAAATGAGGAAGG + Intergenic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178471482 21:32897433-32897455 CCTCATCTAGAAAACGAGGATGG - Intergenic
1179000183 21:37450441-37450463 CCCCCTCTGTAAAGTGAGGTGGG + Intronic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180175482 21:46085120-46085142 CCTCCTCTGTCACAGGGGCAGGG - Intergenic
1180175537 21:46085376-46085398 CCTCCTCTGTCACAGGGGCAGGG - Intergenic
1180175620 21:46085760-46085782 CCTCCTCTGTCACAGGGGGAGGG - Intergenic
1180904363 22:19398274-19398296 CTTCGTCTGTAAAAGGAGTGAGG - Intronic
1181876104 22:25942115-25942137 CCTCCTCTATAAAATAGGGATGG - Intronic
1181956086 22:26589189-26589211 CCCCATCTGTAAAAGGGGAAGGG + Intronic
1182086381 22:27563917-27563939 CCCCATCTGTAAAATGAAGAGGG + Intergenic
1182247554 22:28971615-28971637 CCTCATCTGTAAAATAAGAATGG - Intronic
1182413481 22:30206121-30206143 CCTCATCTGTAAATGGAGGCGGG - Intergenic
1183060527 22:35333815-35333837 CCTCCTCTTTAACAGGAGTAGGG + Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183273298 22:36875519-36875541 CTTCTTCTGTAGAGGGAGGAGGG - Intronic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183389710 22:37538579-37538601 CCTCTTCTGTAAAGGGGGGAAGG - Intergenic
1183629077 22:39022310-39022332 CCTCCTCTGTAAGATGGGAATGG + Intronic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1183632562 22:39042100-39042122 CCTCCTCTGTAAGATGGGAATGG + Intronic
1183638390 22:39078502-39078524 CCTCCTCTGTAAGACGGGAATGG + Intronic
1183641955 22:39098122-39098144 CCTCCTCTGTAAGATGAGAATGG + Intronic
1183653267 22:39171123-39171145 CCTCCACAGTACAGGGAGGAGGG + Intergenic
1184093087 22:42302492-42302514 CTTCCTCTGTGAAAGGGGCATGG - Intronic
1184581754 22:45422677-45422699 CTTCTTCTGTAACATGAGGATGG + Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1184893531 22:47393735-47393757 CCTCCTCTGTCCAAGGAGACAGG + Intergenic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949807279 3:7969623-7969645 CCTCCTCTGTAAAATGAAGGTGG - Intergenic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950481940 3:13249690-13249712 CCTCTTCTGAAAAACGAGGTGGG + Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950736645 3:15014272-15014294 CCTGCTCTGTTAAGGCAGGATGG + Intronic
950900405 3:16492435-16492457 CCTCATCTATAAAAGGAACACGG - Intronic
951139352 3:19143545-19143567 CCACCTCTTTAAAATTAGGATGG + Intergenic
951793122 3:26508484-26508506 CCTCCTGTGTAAAATGAGGTCGG - Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952191804 3:31030508-31030530 CCTCCTCTGTAAAATGGAGCCGG + Intergenic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953475552 3:43202968-43202990 CCTCCTCTGTAAATGAGGGCTGG - Intergenic
953691578 3:45124398-45124420 CCTTCTCTGTCCAAGGAAGATGG + Intronic
953943603 3:47125554-47125576 CCTCATCTGTAAAACAAGTAAGG - Intronic
954002374 3:47567709-47567731 CCCCATCTATAAAAGGAAGAAGG + Intronic
954078278 3:48196955-48196977 CCTCCTCTGTGAAATGAACACGG - Intergenic
954619272 3:51986398-51986420 CCTCATCTGTAAAAGCAGCAGGG - Exonic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955137912 3:56238333-56238355 CATCCTCTGAACAAGGAGAAGGG - Intronic
955432923 3:58868548-58868570 TCTCCTCTGTAAAATGGGAATGG - Intronic
955727383 3:61947860-61947882 CCTCCTCTGAAAAAGGAGGCAGG - Intronic
955842573 3:63128012-63128034 CCTCATCTGTGAAATGAGCATGG - Intergenic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
955976915 3:64488761-64488783 CTTCCTCTGTAAAAGCAGCATGG + Intergenic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956718628 3:72099385-72099407 CCTCCCTAGTAAAAGCAGGAAGG - Intergenic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
958523042 3:95216033-95216055 TCTCCTCTCTCAAAGGATGAAGG + Intergenic
959021794 3:101195529-101195551 CCTCATCTGTAAATGGGGGCTGG - Intergenic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
961622606 3:128236400-128236422 CCTCATCTGTAAATGGCGGGGGG + Intronic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
963310640 3:143706668-143706690 TCTCCTCTGTAAGGGGTGGAGGG + Intronic
963348368 3:144123571-144123593 CCTCGTCTATAAAATCAGGAGGG - Intergenic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
965633398 3:170756368-170756390 CTACCTCTGTAAAATAAGGAGGG - Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG + Intronic
967874415 3:194257168-194257190 CCGCCTCTGTGACAGGAGGCGGG - Intergenic
967925005 3:194639119-194639141 TCCTTTCTGTAAAAGGAGGAAGG + Intergenic
967991550 3:195135310-195135332 CCTCCTGTGTAAAATGAGAAAGG - Intronic
968259040 3:197304290-197304312 CCTTCTCTCTAAAAGAAAGATGG - Intergenic
968474187 4:795430-795452 CCTCCTCTGGAAACGGGGGCGGG - Intronic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969350160 4:6593656-6593678 CCTCCGCTGTAAAATGGGGATGG + Intronic
969524327 4:7696494-7696516 CCTCATCTGTAACATGAGGTTGG + Intronic
970030038 4:11663854-11663876 CCTCCTCTGATCTAGGAGGAAGG - Intergenic
970200345 4:13598531-13598553 CCTCGTTTGTAAAATGAGGGTGG + Intronic
970206317 4:13659039-13659061 CATCAGCTGTAAAATGAGGAGGG - Intergenic
970322494 4:14888579-14888601 CCTCCTCTAGAGAATGAGGATGG - Intergenic
970327659 4:14944148-14944170 CCTTCTTTGTAAAAGGTGGGTGG - Intergenic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
970991307 4:22216338-22216360 CCTCAGCTATAAAATGAGGATGG + Intergenic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
971387170 4:26151593-26151615 CTTCCTCTGTAAAAGGGAGGTGG - Intergenic
972324883 4:38006027-38006049 CCTGCTATGTAAAATGAGAAAGG - Intronic
972419155 4:38870028-38870050 GCTCCTCTGTAAAGCTAGGATGG - Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
975438664 4:74384185-74384207 CTTCATCTGTAAGATGAGGATGG + Intronic
975635914 4:76447975-76447997 CCTTCTCTGTTAAAGAAGCAAGG - Intronic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976209110 4:82649739-82649761 ACTCCAGTGTAAGAGGAGGAAGG - Intronic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976261506 4:83149555-83149577 CCTCCTCTTTGAAAGAAGAATGG - Intergenic
976303590 4:83537478-83537500 CCCTCTCTGTAAAAGGGGGTTGG - Intronic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
977235077 4:94498690-94498712 CATCCACTGTAAGATGAGGAGGG + Intronic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
979353218 4:119670423-119670445 CCTTGTCTGTAAAATGAGAATGG + Intergenic
979624674 4:122831101-122831123 CCTCTTCTGTAAAAAGAGATGGG - Intronic
981812260 4:148789356-148789378 CCTCCTCTATAAGCAGAGGATGG + Intergenic
983661548 4:170134757-170134779 CCTGCTCTGACAAAGGTGGAAGG + Intergenic
983839170 4:172435026-172435048 GCTCCTCAGTAAAAGGAGAATGG + Intronic
984408803 4:179369541-179369563 CCTCAACTGCAAAAGGACGAGGG - Intergenic
984559310 4:181250209-181250231 CCTCCTCTATAATAGGAGGGAGG - Intergenic
984923042 4:184782719-184782741 CCTCCCCTGTAGAAGGAGCTAGG - Intronic
985952820 5:3236465-3236487 CCTCCTCTGTTCAAAGAGGAGGG + Intergenic
985970830 5:3377270-3377292 CCCCCTCTGTAAAACCAGGAGGG + Intergenic
986116683 5:4782253-4782275 GCTCCTGGGTAAATGGAGGAAGG - Intergenic
988392517 5:30653954-30653976 CCACCTCTATAAATGGAGGAGGG + Intergenic
988848742 5:35157460-35157482 TCTGCTCTGTTAAGGGAGGAGGG - Intronic
989110451 5:37902109-37902131 CCTCCTCTCTAAAATGAGGAAGG + Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990884947 5:60580599-60580621 GCTCCTCTGTCAAAGCATGAGGG - Intergenic
990970926 5:61505366-61505388 CCCTCTCTTGAAAAGGAGGAGGG + Intronic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
992940062 5:81751903-81751925 CCTCCTCTGTAAGAGGTGAGCGG + Intergenic
993414844 5:87614287-87614309 CCTCCTTTGCAAAAGGATGTAGG + Intergenic
993929459 5:93920310-93920332 CCTCATCTGAAAAGGGAAGATGG - Intronic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
995435571 5:112131286-112131308 CCTCCTTTGTAAAATGAGTATGG + Intergenic
995441146 5:112193599-112193621 TCTCTTCTGAAAAATGAGGAAGG - Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
996624806 5:125557723-125557745 CTTCCTCTTATAAAGGAGGAAGG - Intergenic
996752505 5:126903214-126903236 CCTCAACTGTAAATGCAGGAAGG + Intronic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999456566 5:151721352-151721374 CCTCCTCTGAAAAATGAAAAGGG + Intergenic
999528751 5:152437976-152437998 CCTCCTCAGCAAAAGGAAGTTGG - Intergenic
999571305 5:152923037-152923059 CCTCATCTGTAATATGAGGGTGG - Intergenic
999769815 5:154766879-154766901 CCTCTTCTCTGAAAGGAGGAAGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
999996231 5:157095035-157095057 CCTTCACTGTAAAATGGGGATGG + Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001699117 5:173694054-173694076 CCTCCTCTCTAAAATGGGGATGG - Intergenic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002062054 5:176630838-176630860 CCTCCTCTGTAAAACAGGAATGG + Exonic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1002638751 5:180620608-180620630 CATCTTCTGTAACATGAGGAGGG - Exonic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004121905 6:12831917-12831939 CCTCCTCCATAAAATGAGGAGGG - Intronic
1004133233 6:12941378-12941400 TCACCTCTGTAAAATGATGAAGG + Intronic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1004533319 6:16475071-16475093 TCTCATCTATAAAAGGAGTAGGG - Intronic
1005181953 6:23116008-23116030 AGTCCTCTGTAAAAGGAAGCTGG + Intergenic
1006402230 6:33824635-33824657 CCTCCTATGAAACAGGAAGAGGG + Intergenic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008072260 6:47109573-47109595 CTTACTCTGTAAGAAGAGGAGGG + Intergenic
1008723581 6:54389220-54389242 TCACCAATGTAAAAGGAGGAAGG - Intronic
1010166574 6:72921601-72921623 CCTCCTCAGTAAAATTGGGAAGG + Intronic
1010442801 6:75917984-75918006 CCTCTTCCATAAAAGGAGGCAGG - Intronic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015301257 6:131655355-131655377 CATTCTTTGTAAAATGAGGATGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1016403887 6:143709780-143709802 CCACCTCTGTATTAGGGGGAAGG + Intronic
1016627745 6:146192177-146192199 CATTCTCATTAAAAGGAGGATGG - Intronic
1017732675 6:157331473-157331495 CTTCCTCTGTAAAGTGAGGAAGG + Intergenic
1018331463 6:162732213-162732235 TCTCCTCAGGAAAAGGATGAAGG + Intronic
1018850822 6:167589084-167589106 GCTCCTCTGAAGGAGGAGGATGG - Intergenic
1019102856 6:169646221-169646243 CCTCTTCTGTTAAGGGAGGATGG - Intronic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019729996 7:2624289-2624311 CCCCAGCTGTAACAGGAGGAGGG - Intergenic
1020678135 7:11204127-11204149 CTACCTCTGTAAAATGGGGACGG + Intergenic
1020816652 7:12913905-12913927 CCTCCTGTGTAGAACAAGGAAGG - Intergenic
1021403597 7:20238069-20238091 CCTGGTCTGAAAAGGGAGGAGGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022266182 7:28757193-28757215 CCTCCTCTGTAAAATAAGAATGG - Intronic
1022417771 7:30192550-30192572 CCTCATCTATAAAAAGAAGATGG + Intergenic
1022497347 7:30861408-30861430 CCTCCTCTGAAAAACAGGGATGG - Intronic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1023124927 7:36946006-36946028 CCTCTCCTGCCAAAGGAGGATGG + Intronic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023272247 7:38476762-38476784 CCTCCTCTATAAAAGGAGATTGG - Intronic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1024369155 7:48559920-48559942 TCTCCTCTCTAACAGAAGGAAGG + Intronic
1024557691 7:50617515-50617537 CCTCCACTGGAAGAGGAGGTGGG + Intronic
1024803666 7:53110686-53110708 CCTATTCTATAAAATGAGGAAGG + Intergenic
1025295722 7:57774168-57774190 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1026052918 7:66961851-66961873 CCTCATCTGTAAAACAAGGATGG + Intergenic
1026104764 7:67411977-67411999 CCTCATCTGTAAAAACAAGAAGG + Intergenic
1026228001 7:68459567-68459589 CCTCCTCTGAGGATGGAGGATGG + Intergenic
1026458790 7:70595675-70595697 CCTCCTCTGTAACATGAAGTTGG + Intronic
1026869577 7:73842210-73842232 CCTCCTCTGAAGGGGGAGGAGGG - Intronic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029527266 7:101102622-101102644 CCTCATCTTTAAAACGAGGATGG - Intergenic
1029734974 7:102460600-102460622 CCTCCTTTGTAAAATGGAGAAGG - Intronic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030081565 7:105783082-105783104 CCTCGTCTATAAAATAAGGATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030867473 7:114717232-114717254 TTCCCTCTGTAATAGGAGGAAGG + Intergenic
1030926682 7:115465784-115465806 CTTTCTCTGTAAAACGAGGATGG - Intergenic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1031949066 7:127873168-127873190 CCTGCTCAGAAAAAGGAGAAAGG - Intronic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032419693 7:131768185-131768207 CATCCTCTGAAAATGCAGGATGG - Intergenic
1032658938 7:133961954-133961976 CCTCCTCTGAGAAATGAGGGCGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1034343052 7:150370112-150370134 CCTCCTCCGCGGAAGGAGGAAGG - Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1034683915 7:152952999-152953021 TCTCATCTAAAAAAGGAGGATGG + Intergenic
1035087457 7:156272995-156273017 GTTACTCTGTAAAGGGAGGAAGG - Intergenic
1035905851 8:3509497-3509519 CCTCATCTTTAAAATGAAGAAGG + Intronic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1037912118 8:22749695-22749717 GCTCCTCTGTAAAAGGCAGGGGG - Intronic
1038352214 8:26787032-26787054 CCTCATCTGTAAGATGAGGTTGG - Intronic
1038712377 8:29959527-29959549 CTTCTTTTGTAAAAGGAGAATGG - Intergenic
1039380093 8:37076798-37076820 CATCCACTCTAAAAGGAAGATGG - Intergenic
1039518771 8:38153810-38153832 CCTCCTCTCTGAAAGGTAGAGGG - Intergenic
1040417764 8:47210418-47210440 GCTCCTCTGTGACAGCAGGAAGG + Intergenic
1040566166 8:48569835-48569857 CCTCCTCTAGACCAGGAGGATGG + Intergenic
1040621843 8:49100547-49100569 CCTCCTCTGGAAGAGTAGAAAGG + Intergenic
1041045771 8:53884553-53884575 CCTCATCTGTAAAACGAAGGAGG - Intronic
1041062208 8:54045127-54045149 CCTCTTCTGTAAAATCAAGATGG + Intergenic
1041275804 8:56156683-56156705 CCTGCTCTATAAAAGGCGGATGG - Intergenic
1041558422 8:59185893-59185915 CCTCCTCTGAATAAGAAAGAGGG + Intergenic
1041669245 8:60476423-60476445 CCTCTCCTGAAATAGGAGGACGG - Intergenic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042295463 8:67212682-67212704 CCTGCTGTGTGAAAGGAAGATGG + Intronic
1042413578 8:68492974-68492996 CCTTCTCTGTAAAATGTAGATGG + Intronic
1042847992 8:73187376-73187398 CCTCGCGTGTACAAGGAGGAAGG - Intergenic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044833177 8:96270018-96270040 CCTCCTCAGTAAACAGAGGATGG - Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044928941 8:97233535-97233557 CTTCATCAGTAAAACGAGGACGG + Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1044999981 8:97870175-97870197 CCTCATCTGTCTAATGAGGATGG + Intronic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045547969 8:103144947-103144969 CCTCACTTGTAAAAGGAGGGTGG - Intronic
1046017439 8:108621789-108621811 CCATCTGTGTAAAATGAGGATGG + Intronic
1046793141 8:118343079-118343101 CCTCATCTGTAAGATGAGAAGGG + Intronic
1046971314 8:120226610-120226632 CTTCCTCTGTAAACCGAGGAAGG - Exonic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047411596 8:124628794-124628816 CCCCATCTTTAAAATGAGGATGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047507567 8:125491829-125491851 CCTCCTGTGTCAGAGGAGGCTGG + Intergenic
1047528540 8:125654887-125654909 CCTCCTCTGTAAAACATGGCAGG + Intergenic
1047742081 8:127814587-127814609 CAACATCTGTAAAATGAGGATGG - Intergenic
1048291290 8:133183576-133183598 CCTCTTTTATAAAAAGAGGATGG - Intergenic
1048338843 8:133523466-133523488 CCTCCTCTGTAAAGTGAAGATGG + Intronic
1048468248 8:134685177-134685199 TCTCCTCTGTAAAAAGGGGATGG - Intronic
1049168573 8:141142787-141142809 CCTCTTCTGTAAAATGTAGATGG + Intronic
1049414178 8:142487894-142487916 CTCCCTCTGTAGAAGGGGGATGG - Intronic
1049967257 9:790904-790926 CCTCTTTTTTAAAATGAGGATGG - Intergenic
1050016847 9:1242885-1242907 CCTCATCTGTTAAAGAAGAAAGG + Intergenic
1050292874 9:4175057-4175079 CCTGCTCTTTAAAAGAAGGAAGG - Intronic
1050351218 9:4741967-4741989 CCTCTCCTGTAAAATGAGGTAGG - Intronic
1050772559 9:9220852-9220874 CCTCTTCAGTAAAAGCTGGAGGG - Intronic
1051604769 9:18908425-18908447 ACTCCACTGGGAAAGGAGGACGG - Exonic
1051922392 9:22283205-22283227 CCTCTTCTGTAAAATGAAGTTGG - Intergenic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053792030 9:41693472-41693494 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054153126 9:61621293-61621315 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054160073 9:61667350-61667372 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1054160259 9:61668230-61668252 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1054160717 9:61670661-61670683 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1054161012 9:61672072-61672094 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1054161463 9:61674522-61674544 ACTGCTCTTTCAAAGGAGGAAGG - Intergenic
1054173026 9:61857480-61857502 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1054173663 9:61860777-61860799 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1054180435 9:61905492-61905514 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054447879 9:65386530-65386552 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1054448518 9:65389842-65389864 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1054472920 9:65552497-65552519 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054657156 9:67675650-67675672 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054663877 9:67720004-67720026 ACTGCTCTTTCAAAGGAGGAGGG + Intergenic
1054664516 9:67723301-67723323 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1055139395 9:72858566-72858588 CCTCCCCTGTAAAATATGGAAGG + Intergenic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1055625776 9:78175992-78176014 CCACTTCTGGAAAAGGAGAACGG - Intergenic
1056282407 9:85054389-85054411 CCTCCTTTGTAAAATGGGGTTGG + Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056791748 9:89630240-89630262 CTGCTTCTGGAAAAGGAGGAGGG - Intergenic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1057774271 9:97993247-97993269 CCTTCTCTGTAAATGGGGGAAGG + Intronic
1057849591 9:98555011-98555033 CCTCCTCTGTAAATGGACTGGGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058766499 9:108187359-108187381 AATCCTCTGTACAAGGAGGAAGG + Intergenic
1058886013 9:109321323-109321345 CCTCTTCTGGAAAAGGAGAGGGG + Intergenic
1058907438 9:109493352-109493374 CCCCCTCTGTAAAATGGGGCTGG + Intronic
1058985605 9:110206762-110206784 GTTCCTCTGTTAGAGGAGGAAGG + Intronic
1059414599 9:114155344-114155366 CCCCATCTATACAAGGAGGAGGG + Intergenic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059620411 9:115998478-115998500 CCTTCTGTGTAAAATGAGAATGG + Intergenic
1059670235 9:116484311-116484333 CTACCTCTGGAAAAGGAGGCTGG - Intronic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060136362 9:121159131-121159153 CCTCCTCTGTAAAATCAGTTTGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060375989 9:123115426-123115448 CCTCCTCTGTGCAGGGAGAAAGG - Intronic
1060471984 9:123955792-123955814 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1060520231 9:124290228-124290250 CCTTCTCTGTGAAATGAGGCTGG + Intronic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060745969 9:126131177-126131199 CCTCTACTTTAACAGGAGGAGGG - Intergenic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061390215 9:130313485-130313507 CCTCGTCTGTGAAACGAGGAGGG + Intronic
1061641378 9:131959507-131959529 GGCCCTCTGTACAAGGAGGAGGG - Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062164530 9:135100728-135100750 CCTCCTCTGTAAAATGGTGCAGG + Intronic
1062434607 9:136541394-136541416 CCTCCGCTGTAGAAGGGGCATGG - Intronic
1203664650 Un_KI270754v1:14260-14282 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203665219 Un_KI270754v1:17076-17098 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203666357 Un_KI270754v1:22712-22734 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203667506 Un_KI270754v1:28351-28373 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203668654 Un_KI270754v1:33990-34012 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203669213 Un_KI270754v1:36807-36829 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1203669500 Un_KI270754v1:38216-38238 ACTGCTCTTTCAAAGGAGGAGGG - Intergenic
1185619573 X:1445225-1445247 AATCCTCTTTATAAGGAGGACGG - Intronic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1186873832 X:13797788-13797810 CATCTTCAGTAAAAGCAGGAAGG + Intronic
1187031630 X:15493713-15493735 CCTCCTCTATAAAATGAGGATGG + Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1187987077 X:24825722-24825744 CCTCCTCAAGAAAAGGAAGATGG - Intronic
1188928328 X:36073630-36073652 CCTCATCTGTGATATGAGGAAGG + Intronic
1189277179 X:39795312-39795334 CCTCCGCTGCAAAAAAAGGAAGG - Intergenic
1189300976 X:39952082-39952104 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189546019 X:42043358-42043380 CCTATTCTGAAAAATGAGGATGG - Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190227606 X:48558285-48558307 CATCGTCTGTAAAATGAGAATGG + Intronic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1193352833 X:80482231-80482253 CCTCTTCTTTAAAAGCAGCAGGG + Intergenic
1193431293 X:81409424-81409446 CCTCAACTGTAAAAGGAGAGTGG + Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1195706675 X:107742637-107742659 CCTCCTTCATAAAAGGAGCAAGG + Intronic
1195766222 X:108298806-108298828 CCTCCTTCATAAAAGGAGCAAGG - Intronic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197955436 X:131941805-131941827 CTTCCTTTTTAAAAGGAGTAAGG - Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1199812553 X:151365197-151365219 TCTCATCTGTAAAAGAAGGCAGG - Intergenic
1200059652 X:153478603-153478625 TCTCCTCTGTAAAATGGGGTAGG - Intronic