ID: 900457221

View in Genome Browser
Species Human (GRCh38)
Location 1:2783164-2783186
Sequence CAGCCATGTCTGCCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900457221 Original CRISPR CAGCCATGTCTGCCACAGAC AGG (reversed) Intronic
900393954 1:2445528-2445550 CAGCCAGCTCTGCCAGAGGCTGG - Intronic
900457221 1:2783164-2783186 CAGCCATGTCTGCCACAGACAGG - Intronic
900566879 1:3337660-3337682 CAACCATCTCTGCCCCAGGCTGG + Intronic
900797273 1:4715895-4715917 CAGCCAGCTTTGCCACATACTGG + Intronic
901464680 1:9413599-9413621 CAGCCAGCTCTGGCACAGCCTGG + Intergenic
903908778 1:26706680-26706702 CAACAATGTCTACCCCAGACAGG - Intronic
904900931 1:33856435-33856457 AAGTCATGTCTGCCAGTGACAGG - Intronic
907320483 1:53599123-53599145 CAGCCAGGTCAGTCACAGACAGG - Intronic
910036811 1:82798793-82798815 AAACCATGTCAACCACAGACTGG + Intergenic
910268186 1:85363321-85363343 GAGACATGTCAGCCACAGACAGG - Intronic
910672330 1:89785694-89785716 GAACCATGTCTGACACAGGCTGG + Intronic
911127462 1:94353747-94353769 CAGGCATGATGGCCACAGACAGG + Intergenic
912472323 1:109914245-109914267 CAGCCATGTCTGTGACAGAGAGG - Exonic
922223033 1:223622955-223622977 CAGGCATGTCTGCACCTGACAGG + Intronic
922384827 1:225072533-225072555 CAGCCATCTCAGCCTCAGTCTGG + Intronic
922788355 1:228294967-228294989 CCCCAGTGTCTGCCACAGACAGG - Exonic
923277414 1:232409679-232409701 CAGCCATTCCAGACACAGACAGG + Intronic
1062898613 10:1124570-1124592 CCTGCATGTCTGCCACAAACGGG - Intronic
1063688240 10:8258776-8258798 CAGCAGCCTCTGCCACAGACAGG + Intergenic
1063901560 10:10738035-10738057 CACCCAGGTCTGCCACAGGTGGG + Intergenic
1064167193 10:12996768-12996790 CATCCATGTCTGCAAAGGACAGG - Intronic
1068091936 10:52442467-52442489 CAGCCACATCAGCCACGGACTGG - Intergenic
1068810968 10:61255969-61255991 CAGCCATCTCAGCCTCAGCCTGG + Intergenic
1069113606 10:64476753-64476775 CAGCCATATCTCCCAGAAACAGG - Intergenic
1069717971 10:70532883-70532905 CACCCATGTCTCCCACAGTGGGG + Intronic
1070364793 10:75726136-75726158 CATCCATGCCTTCCACATACAGG - Intronic
1071361682 10:84852267-84852289 CAGGGATGTCTGCCAAAGAAGGG - Intergenic
1072240233 10:93489249-93489271 TGGCCATGTCTGCCACAAATGGG - Intergenic
1072552644 10:96490990-96491012 CAGCCATGTCGAACACAGAGAGG - Intronic
1072804329 10:98415129-98415151 CAGCCATTTCTGCCCCAGGCTGG + Exonic
1075058979 10:119241382-119241404 CAGCCCTGTCAGCAACTGACAGG + Intronic
1075513633 10:123092365-123092387 CAGCCATGACTGCCCCAGCGAGG + Intergenic
1075897528 10:126009986-126010008 CAGCCTTTTTGGCCACAGACAGG + Intergenic
1076737748 10:132466284-132466306 CAGCCCAGCCTGCCCCAGACAGG + Intergenic
1076851626 10:133096102-133096124 CAGACATGTTTCCCACAGTCTGG + Intronic
1077105106 11:838783-838805 CAACCATCCCTGCCACATACAGG + Exonic
1079091035 11:17480453-17480475 CAGCCACCTCTACAACAGACAGG - Intergenic
1081568642 11:44276081-44276103 CAGCCATGTCTGGCCCAGTGGGG + Intronic
1081645024 11:44784196-44784218 CAGGAATGTCTGCCCCAGAAGGG - Intronic
1083120297 11:60505693-60505715 CAGCCTTCTCAGCTACAGACTGG - Intronic
1084642598 11:70434702-70434724 CAGACACGTCTGCCAGAGAGAGG + Intronic
1085471864 11:76763621-76763643 CAGCTATGCCTGCCTCAGCCTGG - Intergenic
1085807896 11:79653254-79653276 TTGCCATGTCTGCAACAAACAGG + Intergenic
1086801533 11:91183166-91183188 CAGCCATCTCAGCCTCAGCCTGG + Intergenic
1086960788 11:92978526-92978548 CATCCATTTCTTCCCCAGACAGG - Intronic
1087074642 11:94118066-94118088 CAGCCATGTATACAATAGACTGG - Intergenic
1087860500 11:103148551-103148573 CACCAATTTCTTCCACAGACTGG - Exonic
1090533035 11:127611023-127611045 CATCCATGTCTGCCAGGGAAGGG - Intergenic
1093055007 12:14547299-14547321 CAGCCAGTCCTGCCACACACAGG + Intronic
1095049351 12:37542885-37542907 CATCCATGTGTGTCTCAGACAGG + Intergenic
1099817691 12:87669549-87669571 CAGAGATGTCTGCAACAGATGGG - Intergenic
1100067866 12:90672228-90672250 CAGGCATTTCTGCCACACAGTGG + Intergenic
1100723861 12:97387703-97387725 CAGCCATGTCTCCCAGGGAGAGG - Intergenic
1100817765 12:98402332-98402354 CAGCCATGGGTGACAGAGACTGG - Intergenic
1102218281 12:111177313-111177335 CAGCCATCTCTGCAAAAGACAGG + Intronic
1102459244 12:113090043-113090065 TAGTGATGTCTGCCACAGGCAGG + Intronic
1102538198 12:113597862-113597884 CAGCCATGTGTGGCACAGCCAGG - Intergenic
1104363302 12:128153874-128153896 CGTCCATGTCTGGCACAGCCAGG + Intergenic
1106384234 13:29268509-29268531 CGAGCATGGCTGCCACAGACAGG - Intronic
1108004332 13:45932073-45932095 CAGCCATCTTTGGCCCAGACAGG + Intergenic
1111930603 13:94509330-94509352 CACCAATGACTGCCACAGCCAGG - Intergenic
1115521305 14:34235358-34235380 GAGCCATCTCTGCCACAGTTGGG + Intronic
1121231952 14:92364832-92364854 CAAGCATGTCTGGCACAGACTGG + Intronic
1122263279 14:100535167-100535189 CTGCAATGCCTGCCACAGCCGGG - Intergenic
1122331044 14:100913414-100913436 CAGCCTTGTGTTCCACAGAATGG + Intergenic
1122593501 14:102872284-102872306 CAGACAGCCCTGCCACAGACAGG - Intronic
1122719181 14:103712656-103712678 CAGGCGTGACTGTCACAGACAGG + Intronic
1122934097 14:104948025-104948047 CATCCTTGTCCGCCACAGACAGG + Exonic
1123893719 15:24807360-24807382 CAGCTTTGCCTGCCACAGCCAGG - Intergenic
1124083580 15:26524208-26524230 CTGCCATATTTGCCATAGACTGG + Intergenic
1124123397 15:26911854-26911876 CTGCCATGTCTGCCAGACCCCGG - Intronic
1125062188 15:35437749-35437771 CAGCAAAGTTTGCCACTGACTGG - Intronic
1126871564 15:52994527-52994549 CAGCCATCTCAGCCTCAGCCTGG + Intergenic
1127368424 15:58312783-58312805 CAGCCATGTGAGCTACAGCCTGG + Intronic
1128235401 15:66063828-66063850 CAGCAATGTCTGACAAAGAGTGG - Intronic
1130003004 15:80063973-80063995 CCACCATGTCTGACCCAGACTGG + Intronic
1132544926 16:528508-528530 CTGGCATGGCTGGCACAGACGGG - Intronic
1132819398 16:1855807-1855829 CAGGCATGTCCTCCACAGCCAGG + Intronic
1133528492 16:6630206-6630228 CATCCCTCTCTGTCACAGACAGG - Intronic
1134867434 16:17620737-17620759 CATCCCTCTCTGCCACAGGCAGG + Intergenic
1135210411 16:20521323-20521345 CAACCATGTCTGCCAGATAAAGG + Intergenic
1136651997 16:31680901-31680923 AAGACATGTCTGGCACAGAATGG - Intergenic
1136671624 16:31863664-31863686 AAGACATGTCTGACACAGAATGG - Intergenic
1137840418 16:51636141-51636163 CAGCCATGGCTGCACCAGAGAGG + Intergenic
1139145002 16:64312672-64312694 GAGCAATGCCTGCCACAGAGTGG - Intergenic
1139802008 16:69530445-69530467 CATCTAGGTCTGCCACAAACAGG - Intergenic
1140173878 16:72636062-72636084 CATTCATGTCTGCTACAGTCTGG - Intergenic
1140267722 16:73434859-73434881 TAGCCATGCCGGCCACTGACTGG - Intergenic
1141447476 16:84070745-84070767 CAGCCCTATTTGCCACAGAACGG - Exonic
1141696423 16:85621986-85622008 CAGCCAGGTCTGCACCTGACTGG + Intronic
1142600109 17:1049669-1049691 GAGCCGTGTCTGCCATTGACGGG - Intronic
1144766001 17:17732852-17732874 CTGCCATCTCTTCCACAGAGAGG + Intronic
1145056714 17:19707930-19707952 GAGCCATGCCTGCCCCACACGGG - Intronic
1145065086 17:19756697-19756719 CAGCAGTGTGAGCCACAGACAGG - Intergenic
1146056043 17:29581698-29581720 CAGCCAGGCCTGTCACAGCCAGG + Intronic
1146685854 17:34841178-34841200 AAGCCCTCTCTGCCACATACTGG + Intergenic
1148158662 17:45437598-45437620 CGGCCCTGCCTGCCCCAGACAGG + Exonic
1148335686 17:46839488-46839510 CAGCCATGACTGCCATGCACAGG + Intronic
1150241429 17:63636782-63636804 CAGCCACTTCTCCCACAGCCGGG - Intronic
1150390083 17:64784997-64785019 CGGCCCTGCCTGCCCCAGACAGG + Intergenic
1150457701 17:65320842-65320864 CAACAATGTCAGCCACACACAGG - Intergenic
1151670486 17:75569298-75569320 CTGCCGTGCCTGCCACAGCCAGG - Exonic
1152622175 17:81370471-81370493 CAGCCATCTCTGCCAGAAGCAGG + Intergenic
1153477384 18:5511816-5511838 CAGAGATGTGTGCCAGAGACAGG + Intronic
1154390389 18:13931739-13931761 CAGGCAGGACTGGCACAGACAGG - Intergenic
1155198728 18:23499439-23499461 CAGGAATGTCTGCCAAGGACAGG - Intergenic
1155419333 18:25637526-25637548 TAGCCATGTCTGCAGCACACGGG - Intergenic
1157551570 18:48585436-48585458 CAGCAATGAATGCCACACACTGG - Intronic
1158102412 18:53844003-53844025 CAGGGATCTCTGCCACAGGCTGG - Intergenic
1158290946 18:55941840-55941862 CAGCAATTTCTGCCACATAGTGG + Intergenic
1159549280 18:69877912-69877934 AAGCCATGTCAGCTACAGGCTGG - Intronic
1160837181 19:1130228-1130250 CAGCCGTGACAGCCACAGACGGG + Intronic
1161271029 19:3389374-3389396 CGGCCTTGTGGGCCACAGACAGG + Intronic
1162076936 19:8194172-8194194 CCCCCATGTCTGCAACAGGCTGG - Intronic
1162096323 19:8311986-8312008 CAGCTATTCCTGCCTCAGACTGG + Intronic
1163345205 19:16736874-16736896 TAGTAATGTCTGCCACAGGCAGG - Intronic
1165486651 19:36100705-36100727 CAGCCATGCCTGCCTCAGAATGG + Intronic
1168142216 19:54395914-54395936 CAGACATCTCTTCCACACACTGG - Intergenic
925992443 2:9264321-9264343 CAGGCATGTCTTCCAGAGACTGG + Intronic
928087589 2:28355636-28355658 CAGCCATGTCTGCTGCATCCAGG - Intergenic
928334988 2:30390326-30390348 TAGCCATGGCTCCCACTGACTGG - Intergenic
928467831 2:31539517-31539539 CAGCCTTTTCTGACACAGCCTGG - Intronic
929793737 2:45042271-45042293 AGGCTTTGTCTGCCACAGACTGG + Intergenic
932876486 2:75457692-75457714 CAGTGATGTCTACCACATACAGG - Intergenic
933765536 2:85706143-85706165 CGGCCATGGCTGCCACAGGATGG + Intergenic
933772179 2:85751605-85751627 CCTCCATCTCTGCCACTGACTGG + Intronic
934668744 2:96193485-96193507 CAGCCATGTCTCTCACACTCTGG - Intronic
936012308 2:108932833-108932855 CAGCCTTGTCTGCCTCGGATGGG - Intronic
936012654 2:108934895-108934917 CAGCCTTGTCTGCCTCAGGTGGG - Intronic
936110696 2:109662084-109662106 CACCCATTTCTGCCACATGCAGG + Intergenic
937235632 2:120430473-120430495 CATGCCAGTCTGCCACAGACAGG - Intergenic
938010060 2:127821748-127821770 CAGTGGTCTCTGCCACAGACTGG - Intergenic
939238192 2:139524536-139524558 CCACAATGTCTGCCACAGCCAGG - Intergenic
940585212 2:155639453-155639475 CTGCTATCTCTGCCACTGACAGG + Intergenic
944326673 2:198413750-198413772 CAGCAATGTCTGCCAAAGGTAGG + Intronic
945219194 2:207466896-207466918 GAGCCATGGCTGCCAGAGAGAGG + Intergenic
945791321 2:214309391-214309413 CAGCCATCTCAGCCTCAGCCTGG + Intronic
946077265 2:217084908-217084930 AAGTCATGTCTGCCACACACTGG + Intergenic
948764328 2:240211819-240211841 CAGCCATCTCTGCCACACTCTGG - Intergenic
948775654 2:240287603-240287625 CAGCCTGGTCTGCCACCGAGGGG + Intergenic
949031507 2:241799411-241799433 CAGCCCTGCCTCCCACACACAGG - Intronic
1168891571 20:1298320-1298342 CAGCCATGGGAGCCACAGGCTGG - Intronic
1171883984 20:30638472-30638494 CAGCTATGTTTGTCACAGCCTGG + Intergenic
1174059048 20:47819450-47819472 CAGCCATGAGGGCCGCAGACAGG + Intergenic
1174140174 20:48407217-48407239 CAGCCATGTCTGCAGCAAACTGG + Intergenic
1174169497 20:48607172-48607194 CAGCCATGTGTCCCCCTGACGGG - Intergenic
1177444282 21:21171587-21171609 CACCCTTGACTGCCACAGACTGG + Intronic
1178704397 21:34861396-34861418 GAGCAATGACAGCCACAGACGGG + Intronic
1180132533 21:45835697-45835719 CAGCCTAGTCTGCCAGAGCCAGG - Intronic
1182127705 22:27828286-27828308 AAGCCATGTTGGCCACAGTCTGG - Intergenic
1183006936 22:34911365-34911387 AAGCCAGGTCTACCACAAACTGG - Intergenic
1183041058 22:35178315-35178337 CAGGCATGTCTGCCAATGCCAGG + Intergenic
1183875140 22:40773873-40773895 CAGCCATCTCTGCCAGGGAGGGG - Intronic
1184813178 22:46851340-46851362 GAGCCATGCCTGCCCCAGCCCGG - Intronic
949624009 3:5848039-5848061 CAGACTGGTTTGCCACAGACTGG - Intergenic
950909730 3:16576481-16576503 TAGCCATGTGGGCCACAGAGGGG - Intergenic
954177971 3:48859263-48859285 CTGCCCTGTCTGCCACAGGCAGG - Intronic
954380919 3:50218575-50218597 CCTCCCTGCCTGCCACAGACGGG + Exonic
959386765 3:105718745-105718767 TAGCCATGTCTGCCCAAGTCAGG + Intronic
960742185 3:120846445-120846467 TAGCCATGTCTACCATAAACAGG + Intergenic
961450087 3:126998756-126998778 CAGCCAGGGCTGCCTTAGACAGG - Intronic
966309151 3:178574579-178574601 CAGGGATGTCTGACACGGACTGG - Intronic
967663462 3:192142690-192142712 CAGCTATGACTCCAACAGACAGG - Exonic
967735261 3:192945124-192945146 CAGCCATTGCTGCCACAACCAGG + Intergenic
968404496 4:328027-328049 CAGCCATCTCAGCCTCAGCCTGG - Intergenic
983928985 4:173432658-173432680 CCTCCATGCCTGCCTCAGACAGG - Intergenic
985107872 4:186516370-186516392 CAGATCTGTCTGCCACCGACAGG - Intronic
990770718 5:59241344-59241366 CAGCCATGGCTGGTACAGGCGGG - Intronic
998732845 5:145100780-145100802 CAGCCCTGTCTGTCTCAGCCTGG + Intergenic
999334075 5:150700468-150700490 AAGACATGTCTGGCACAGAATGG + Exonic
1001999101 5:176187118-176187140 CAGCCATTTCTTCCAGAGGCAGG + Intergenic
1002065312 5:176648680-176648702 CAGCCAGGCCTGCTACAGCCAGG - Intronic
1002634066 5:180598516-180598538 CACCCCTGTGTGCCACAGAGGGG + Intergenic
1002901557 6:1414256-1414278 CTGCCTTTACTGCCACAGACGGG - Intergenic
1004172480 6:13307204-13307226 CAGACATGTCTGAAACTGACTGG + Intronic
1011759460 6:90545684-90545706 TAGCTGTGTCTGCCACAGATGGG - Intronic
1018798644 6:167206385-167206407 CGGCCATGGATCCCACAGACAGG + Intergenic
1018814065 6:167317780-167317802 CGGCCATGGATCCCACAGACAGG - Intergenic
1019082304 6:169443190-169443212 CTGCCACGTCAGCCACAGAATGG + Intergenic
1020117121 7:5482099-5482121 CAGCTCTGTCTGCCACGTACAGG - Intronic
1020505180 7:8977836-8977858 CAGCCATGGTTGCCAAACACTGG - Intergenic
1022301317 7:29105292-29105314 CACCCATGGCTGCCACAGTCTGG - Intronic
1022567715 7:31420169-31420191 CAGCCATCTCTTCCAGACACAGG - Intergenic
1023852728 7:44159213-44159235 CAGCCGTTGCTGCCACAGGCGGG - Exonic
1028222819 7:88217142-88217164 CAGAGATGTCTGACACAGTCTGG - Exonic
1028563669 7:92204374-92204396 CAGACAATTCTTCCACAGACAGG + Intronic
1029610851 7:101625856-101625878 CAGCCAGGTGTGCCAGAGAAAGG - Intronic
1030196156 7:106855701-106855723 TAGTCATCTCTGCCACAGCCAGG - Intergenic
1032589983 7:133183037-133183059 CTGGCATGGCTGCCACAGGCTGG + Intergenic
1034254261 7:149715691-149715713 CATCCATGGCTGCCTCGGACTGG - Intronic
1034536938 7:151731292-151731314 AGGCCATGTCTGGCACAGAAGGG - Intronic
1035577898 8:719638-719660 CAGCGACGTCTGCCACCGCCAGG - Intronic
1035817602 8:2557840-2557862 GAGCATTGTCTGCCACAGATGGG - Intergenic
1035918840 8:3654863-3654885 CTGCCAGCTCTGCAACAGACTGG + Intronic
1039293152 8:36120859-36120881 CAGCCATGTCATCATCAGACAGG - Intergenic
1043270679 8:78329628-78329650 CAGCCCTGTCTGCTCCATACAGG + Intergenic
1045727105 8:105186483-105186505 CAGCAATGGCATCCACAGACTGG + Intronic
1046488958 8:114922295-114922317 CAGCTGTGTTTGCCACAGCCAGG + Intergenic
1047566319 8:126047516-126047538 CAGCCATGGCACACACAGACAGG + Intergenic
1050098618 9:2094492-2094514 CAGCCATGCCTTCCACATTCAGG + Intronic
1051899488 9:22023941-22023963 CAGCCATCTCAGCCTCAGCCTGG + Intronic
1055842841 9:80526634-80526656 CAGCCATCTCAGCCTCAGTCCGG - Intergenic
1056399150 9:86210009-86210031 CAGCACTGTCTGCCACACAGGGG - Intergenic
1059745058 9:117192157-117192179 CAGCAATGCCTCCAACAGACAGG - Intronic
1061359435 9:130131710-130131732 CAGCCATGGCTGCAGGAGACTGG - Intronic
1061710058 9:132481239-132481261 CAGCCCTGTCTCCCCCAGAGCGG + Intronic
1185466436 X:357884-357906 CAGCCCTGACTCACACAGACAGG + Intronic
1185651121 X:1648827-1648849 CAGCCCTGACTGCCTCTGACAGG - Intergenic
1186174072 X:6906849-6906871 CAGCCATGTCTTCCACAATAGGG - Intergenic
1186548554 X:10477680-10477702 CAGCCATGTCTGGGACACATGGG + Intronic
1187994583 X:24912416-24912438 AGGCAATGACTGCCACAGACTGG + Intronic
1188779649 X:34265778-34265800 CAGTCATGTCTGTCACAAAAAGG - Intergenic
1189198789 X:39174296-39174318 CAGCTAGGGCTGCCACAGCCAGG + Intergenic
1189208848 X:39265734-39265756 CAGCCCTGTCTCCCACACAATGG + Intergenic
1189247021 X:39571230-39571252 CAACAATGTCTGTCACACACAGG - Intergenic
1192926665 X:75760819-75760841 CAGCCATCTCAGCCTCAGCCTGG - Intergenic
1193061521 X:77213039-77213061 CAGCCATCTCAGCCTCAGCCTGG - Intergenic
1193517540 X:82487468-82487490 CAGCGGTGGCTGCCAGAGACTGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1194074101 X:89367469-89367491 CAGAGATGTCTGACACAGTCTGG - Intergenic
1195336874 X:103863768-103863790 CAGCCATGTCTACTACACAGGGG - Intergenic
1199691311 X:150310970-150310992 CAGCCCTGTCTGCCTCAGTAAGG - Intergenic
1200071987 X:153533777-153533799 CAGCCATGGCTGCACCAGTCAGG + Intronic
1200181968 X:154156133-154156155 CAGACATGGCTGCCTCAGGCTGG - Intronic
1200181973 X:154156144-154156166 CAGCCATGTCTGCCTGGGGCCGG + Intronic
1200182530 X:154159426-154159448 GCGCCATCCCTGCCACAGACTGG - Intergenic
1200187617 X:154193247-154193269 CAGACATGGCTGCCTCAGGCTGG - Intergenic
1200187622 X:154193258-154193280 CAGCCATGTCTGCCTGGGGCCGG + Intergenic
1200188184 X:154196540-154196562 GCGCCATCCCTGCCACAGACTGG - Intergenic
1200193266 X:154230387-154230409 CAGACATGGCTGCCTCAGGCTGG - Intronic
1200193271 X:154230398-154230420 CAGCCATGTCTGCCTGGGGCCGG + Intronic
1200193834 X:154233680-154233702 GCGCCATCCCTGCCACAGACTGG - Intergenic
1200199021 X:154268191-154268213 CAGACATGGCTGCCTCAGGCTGG - Intronic
1200199026 X:154268202-154268224 CAGCCATGTCTGCCTGGGGCCGG + Intronic
1200199589 X:154271484-154271506 GCGCCATCCCTGCCACAGACTGG - Exonic
1200514232 Y:4122831-4122853 CAGCGTTGTCTGACAAAGACCGG + Intergenic
1200729493 Y:6718996-6719018 CAGAGATGTCTGACACAGTCTGG - Intergenic