ID: 900458559

View in Genome Browser
Species Human (GRCh38)
Location 1:2789394-2789416
Sequence AAAGGAATGAACGGAGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 757
Summary {0: 1, 1: 0, 2: 7, 3: 65, 4: 684}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900458559_900458565 16 Left 900458559 1:2789394-2789416 CCACTGCCTCCGTTCATTCCTTT 0: 1
1: 0
2: 7
3: 65
4: 684
Right 900458565 1:2789433-2789455 CACATCCGTCGCTACCTCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 23
900458559_900458563 -10 Left 900458559 1:2789394-2789416 CCACTGCCTCCGTTCATTCCTTT 0: 1
1: 0
2: 7
3: 65
4: 684
Right 900458563 1:2789407-2789429 TCATTCCTTTGTAAAATAGGAGG 0: 1
1: 0
2: 1
3: 28
4: 312
900458559_900458567 27 Left 900458559 1:2789394-2789416 CCACTGCCTCCGTTCATTCCTTT 0: 1
1: 0
2: 7
3: 65
4: 684
Right 900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900458559 Original CRISPR AAAGGAATGAACGGAGGCAG TGG (reversed) Intronic
900019000 1:174070-174092 AAAGTAATGAAGCAAGGCAGAGG - Intergenic
900030338 1:366736-366758 AAAGGGAGGAAAGGAGGCAGCGG + Intergenic
900049257 1:532665-532687 AAAGTAATGAAGCAAGGCAGAGG - Intergenic
900050992 1:595800-595822 AAAGGGAGGAAAGGAGGCAGCGG + Intergenic
900071490 1:774488-774510 AAAGTAATGAAGCAAGGCAGAGG - Intergenic
900458559 1:2789394-2789416 AAAGGAATGAACGGAGGCAGTGG - Intronic
900703576 1:4062523-4062545 AAAGAGATGGACGGAGACAGAGG - Intergenic
900808411 1:4782771-4782793 AAAGGAAAGAAAGGAACCAGAGG + Exonic
900829052 1:4950957-4950979 AAAGGAAGAAAAGGAGGCACAGG + Intergenic
900863000 1:5246215-5246237 GAAGGAAGGAAGGGAGGAAGAGG - Intergenic
901178535 1:7322958-7322980 AAAGGGAGGAACGGAGGAAGGGG - Intronic
901690127 1:10967398-10967420 CAAGGACTGAAAGGAGGCAGGGG - Intronic
901893607 1:12289491-12289513 GAAGGAATGAACTGAGGCTGAGG + Intronic
901940502 1:12658239-12658261 AAAGGAAGGAAGGAAGGAAGGGG - Intronic
902963838 1:19984026-19984048 AAGGGAATAAAAGGAGGCTGCGG - Intergenic
903093182 1:20941744-20941766 AAAGGAAGGAACTGTGGAAGGGG + Exonic
903304652 1:22404235-22404257 AAGGGGATGGAGGGAGGCAGGGG + Intergenic
904118691 1:28180899-28180921 AGAGGAATGAAGGGAGAGAGGGG + Intronic
905121234 1:35683461-35683483 AAGGGAAGGAACGGGGGAAGAGG + Intergenic
905518432 1:38578975-38578997 AGAGGAGTAAACGGAGGCTGTGG - Intergenic
905716685 1:40157985-40158007 AATGGCGTGAAGGGAGGCAGAGG - Intergenic
905809850 1:40904230-40904252 GCAGGAATGGAGGGAGGCAGTGG - Intergenic
905953565 1:41973691-41973713 CAAGGAATGATAGGAGTCAGAGG + Intronic
906115841 1:43356685-43356707 AAATGAATGAAGGAAGGCAATGG - Intergenic
906122507 1:43403777-43403799 AAAGGATTGAAGGGAGACTGTGG + Intronic
906482687 1:46209862-46209884 AAAGGAAGGAAAGGAGGGAGGGG + Intronic
906693885 1:47811181-47811203 AATGGAATCTAGGGAGGCAGGGG + Intronic
906708144 1:47909797-47909819 GAAGGAAGGAAGGGAGGAAGGGG - Intronic
906787928 1:48632129-48632151 AGAGGAAGGAACTGAGGGAGCGG + Intronic
907517690 1:55003200-55003222 AAAGGAAAGAAATAAGGCAGGGG - Intronic
907541046 1:55215487-55215509 AAACGAAGGAGCGGAGGGAGGGG + Intergenic
907651557 1:56299902-56299924 AATGGAATGCAGGGAGGCAAAGG - Intergenic
908001751 1:59687347-59687369 CAAGGGATGACAGGAGGCAGTGG - Intronic
908437515 1:64121165-64121187 AAAGGAAGGAAGGGAGGGACAGG - Intronic
908437618 1:64121825-64121847 AATGGAAGGAAAAGAGGCAGAGG - Intronic
909105689 1:71404550-71404572 GAAGGAAGGAAGGGAGGAAGGGG - Exonic
909430109 1:75577605-75577627 AAAGGCATAAACGGAAGAAGGGG - Intronic
910203068 1:84719942-84719964 AAAGGCACGAATGGAGGGAGGGG - Intergenic
910243019 1:85108756-85108778 GAAGGAAAGAAGGGAGGCAAAGG - Intronic
910262723 1:85307668-85307690 AAAGGAAGGGAGGGAAGCAGAGG - Intergenic
910651148 1:89569450-89569472 AAAGGAAGGGAGGGAGGCAAGGG - Intronic
910736496 1:90464043-90464065 AAAGGAATGAACTGATGCTTGGG - Intergenic
910936681 1:92488773-92488795 AAAGGAATATATGGAGGGAGAGG - Intergenic
911854550 1:102860292-102860314 AAAGGACAGGAAGGAGGCAGAGG - Intergenic
912362962 1:109110212-109110234 AAAGAAATGAAGTGAGGCTGGGG - Intronic
913027017 1:114854118-114854140 AGAGGAGAGAAAGGAGGCAGAGG - Intergenic
913115652 1:115694291-115694313 AAAGGCAAGAACAGAGGCGGGGG - Exonic
913207863 1:116557660-116557682 AAAGGAAGGAAGGAAGGAAGGGG - Intronic
913212709 1:116594908-116594930 CAGGGCATGAACGGGGGCAGGGG - Intronic
913513168 1:119580898-119580920 AAAGGAATGAATGAAAGCAAAGG + Intergenic
914323685 1:146590172-146590194 AAACGAAGGAAAGGAGGTAGAGG + Intergenic
915440183 1:155941166-155941188 AGAGGAAAGAGCGGAGGCTGCGG - Intergenic
915688810 1:157665697-157665719 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
916065317 1:161131981-161132003 AAAGGAGAGAACGGAGGCTTGGG - Intronic
916127025 1:161580806-161580828 AAAAGAATGAATGAGGGCAGGGG + Intergenic
916136945 1:161662610-161662632 AAAAGAATGAATGAGGGCAGGGG + Intronic
916414986 1:164584101-164584123 GAAGGAAGGAAGGGAGGGAGAGG + Intronic
916524747 1:165598838-165598860 GAAGGAAAGAAAGGAGGGAGTGG + Intergenic
916901865 1:169233907-169233929 AAAGGAAAAAAAGGAGGGAGAGG - Intronic
917408340 1:174733158-174733180 AAAAGAATAAAAGGAGGAAGCGG + Intronic
917446328 1:175108538-175108560 ACAGGAACCCACGGAGGCAGGGG + Intronic
917526496 1:175792760-175792782 AAAAGACTGAATGTAGGCAGAGG + Intergenic
918423354 1:184386233-184386255 AAAGAACTGGACGGATGCAGTGG + Intergenic
918916647 1:190649560-190649582 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
919613561 1:199776954-199776976 AAAGGAAGGAAGGGAGGAAGGGG - Intergenic
919710318 1:200721011-200721033 AAAGGAAGGAAGGGAGGGAGGGG - Intergenic
919827895 1:201516806-201516828 GAAGGAAAGAAAGGAGGGAGGGG + Intergenic
919835931 1:201573383-201573405 AAAGGAAGGAAGGAAGGGAGGGG + Intergenic
920377739 1:205518379-205518401 GAATGAATGAATGGAGCCAGGGG + Intronic
920700057 1:208211108-208211130 AAAGGAAGAAACTGAGGCATAGG - Intronic
921275992 1:213520598-213520620 AAAGGAAGGAAACGAGGGAGGGG - Intergenic
921444062 1:215223578-215223600 AAAGGAATGCATGGTGGAAGGGG + Intronic
921983189 1:221280729-221280751 AAGCGAATGAACGCAGGAAGAGG - Intergenic
922106855 1:222519940-222519962 AAAGTAATGAAGCAAGGCAGAGG - Intergenic
922266406 1:223988362-223988384 AAAGTAATGAAGCAAGGCAGAGG - Intergenic
922428292 1:225520867-225520889 AAAGAAAAGAAAGGAGGAAGCGG + Intronic
922655080 1:227374967-227374989 AAAAGAAGGAAAGAAGGCAGGGG - Intergenic
923433912 1:233950497-233950519 GAAGGAAGGAAGGGAGGAAGTGG - Intronic
923634501 1:235681593-235681615 AAAGGAATGAGCTGGGGCAATGG + Intronic
923776588 1:236984005-236984027 AAAGGAAGGAAGGAAGGGAGGGG + Intergenic
924009456 1:239648705-239648727 CATGGAAAGAACTGAGGCAGTGG + Intronic
924169848 1:241327027-241327049 GAAGGAAGGAAGGGAGGGAGGGG + Intronic
924349036 1:243097507-243097529 AAAGTAATGAAGCAAGGCAGAGG - Intergenic
924370180 1:243339144-243339166 AAGGGAATGATGGGTGGCAGAGG + Intronic
924423933 1:243933804-243933826 AAAGGAAGGAAGGGAGGGGGAGG - Intergenic
924491973 1:244546806-244546828 AAAGGAATGAAGAAAGCCAGTGG + Intronic
924782500 1:247165051-247165073 AATGGCATGAACCGGGGCAGCGG - Intronic
1063233252 10:4086748-4086770 AAAGGAATGAGATGAGGGAGCGG - Intergenic
1063565383 10:7168932-7168954 AAAAGAATGATTGGAGGCAGAGG - Intronic
1063692139 10:8296980-8297002 GAAGGAAAGAAGGGAGGGAGGGG - Intergenic
1064116311 10:12580319-12580341 AAAGGAAGGAAGGGAGGGAGGGG - Intronic
1064161803 10:12952981-12953003 AAAGGAAGGAAGGGAGGGAGGGG + Intronic
1064299607 10:14111936-14111958 GAAGGAAGGAAGGGAGGGAGAGG + Intronic
1064460048 10:15525666-15525688 AAAGGAGTGAAAAGAAGCAGGGG + Intronic
1065061909 10:21910815-21910837 AAAGGAAAGAAAGGAAGGAGAGG + Intronic
1066290517 10:34010430-34010452 AGAGGAAGGAAGGGAGGCAGAGG + Intergenic
1066457447 10:35584665-35584687 AGAGGAATGAAGGGAGGCGGTGG + Intergenic
1066482905 10:35814294-35814316 GAAGGAATGAACTGTGGCAGGGG - Intergenic
1066727330 10:38407401-38407423 AAAGTAATGAAGCAAGGCAGAGG + Intergenic
1067733251 10:48829149-48829171 AAAGGAATGAATCGATGCATAGG + Intronic
1068342690 10:55728558-55728580 AAAGGAAAGAAAAGGGGCAGGGG + Intergenic
1069265697 10:66454793-66454815 AGAGGAATGAGAGGAGGGAGAGG + Intronic
1069462932 10:68611914-68611936 AAAGGAAGGGAGGGAGGAAGGGG + Intronic
1069950675 10:72016146-72016168 AAAAGAAGGAAGGGAGGGAGGGG + Intergenic
1070437300 10:76405801-76405823 AAAGGAACGCACGGGGGCTGAGG - Intronic
1071771720 10:88736143-88736165 AAAGGAAGGGAAGGAGGGAGAGG + Intronic
1072454958 10:95567588-95567610 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
1073192270 10:101660071-101660093 AAAGGAAGGAAGGGCGGGAGGGG + Intronic
1074375851 10:112940165-112940187 AAAGGAAGGAAGGAAGGAAGGGG + Intergenic
1074584930 10:114758592-114758614 ATAGGAATGAACAGAAGGAGAGG - Intergenic
1074794069 10:116923541-116923563 AAAGGAAAGAAAGGAAGCATTGG - Intronic
1074815587 10:117139391-117139413 AAAGGAATGAATGGGGAGAGCGG - Intergenic
1074909677 10:117896548-117896570 AAAGAAAGGAAGGGAGGGAGAGG + Intergenic
1075431214 10:122383212-122383234 AAGGGAATAAACGGAGGCACTGG - Intronic
1076247535 10:128959029-128959051 AATGGAGTGAGAGGAGGCAGCGG - Intergenic
1076303868 10:129449522-129449544 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
1076784619 10:132743533-132743555 AAATGAATGAATGGAGGGAGGGG - Intronic
1076975601 11:169260-169282 AAAGTAATGAAGCAAGGCAGAGG - Intronic
1078011818 11:7578212-7578234 CAAGGAATGAACGGACGTTGGGG + Intronic
1078540174 11:12206839-12206861 AAAGGAAGGAAGGAAGCCAGAGG - Intronic
1078867771 11:15313821-15313843 AAAGAAATGAAGTGAAGCAGTGG - Intergenic
1079006114 11:16792247-16792269 AATGGAATGTCTGGAGGCAGAGG + Intronic
1079424657 11:20328657-20328679 AAAGGAAGGGAGGGAGGGAGGGG - Intergenic
1079934550 11:26600575-26600597 AGAGGAAGGAAGGGAGGGAGAGG - Intronic
1080027190 11:27627226-27627248 AAAGGTATGTATGGAGGCAGAGG - Intergenic
1080082083 11:28233783-28233805 AAAAGAAAGAATGGAGTCAGAGG - Intronic
1080360205 11:31504948-31504970 AAAGGAATTACCGGAGGTTGAGG + Intronic
1080432798 11:32214242-32214264 AGAGGAAAGCACTGAGGCAGAGG + Intergenic
1080454826 11:32408556-32408578 AAAGAAAAGAAGGAAGGCAGAGG + Intronic
1081132953 11:39402877-39402899 AAAGGAAGGCAGGCAGGCAGCGG - Intergenic
1081479126 11:43467816-43467838 AAAGGAATTTGTGGAGGCAGAGG + Intronic
1081502012 11:43676186-43676208 ATAGGAATGAAAAGAGGAAGAGG + Intronic
1081692890 11:45089948-45089970 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
1082849870 11:57754921-57754943 AAAAGAAGGAAGGGAGGGAGGGG - Intronic
1084742760 11:71150079-71150101 AGAGGAAGGAAGGGAGGGAGAGG + Intronic
1085845929 11:80064671-80064693 TAATGAGTGAAAGGAGGCAGAGG + Intergenic
1085982666 11:81744134-81744156 AAGGGAATAAAAGGAGGCTGGGG - Intergenic
1086021924 11:82240250-82240272 AAAGGAATGGACAGAGCCAGAGG - Intergenic
1086509494 11:87541816-87541838 ACAGAAATGAAAGGGGGCAGAGG + Intergenic
1086787291 11:90984778-90984800 AAGGGAAAGAGCGTAGGCAGTGG - Intergenic
1087527149 11:99330153-99330175 AAAGGAAGGAAGGGAGGGAGGGG + Intronic
1088457098 11:110044329-110044351 GGAGGAATGGAAGGAGGCAGAGG - Intergenic
1088731605 11:112688717-112688739 CAAGGATAGAAGGGAGGCAGTGG + Intergenic
1089666266 11:120021949-120021971 AAAGGAATGGTCAGAGCCAGCGG - Intergenic
1090044199 11:123316806-123316828 GAAGGAAGGAAGGGAGGAAGGGG + Intergenic
1090253936 11:125270035-125270057 AAAGGAATGAGCAGAGGCGATGG - Intronic
1091436466 12:477163-477185 AAGGGAATGAGCGAAGGCAGAGG - Intronic
1092002088 12:5041355-5041377 AAAGGAAGGAGGGGAGGAAGAGG + Intergenic
1092509127 12:9135055-9135077 GAAGGGATGCAAGGAGGCAGAGG - Intergenic
1092652741 12:10652278-10652300 AAATGAATGAAGGGAGGAGGGGG - Intronic
1093521618 12:20057750-20057772 GAAGGAAGGAAGGGAGGAAGGGG - Intergenic
1093527053 12:20115311-20115333 ACAGGAACCCACGGAGGCAGGGG + Intergenic
1093778605 12:23107077-23107099 AAAGAAATGAAGGGAGGCAGAGG + Intergenic
1093791367 12:23254211-23254233 AAAGGAATGAAATGATGCAAGGG + Intergenic
1094292140 12:28863542-28863564 AAAGGAAGGAAGGAAGGAAGAGG - Intergenic
1095444645 12:42271768-42271790 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
1095682296 12:44992005-44992027 AAAGGAATGATGGGAAGCAGGGG + Intergenic
1095912086 12:47438324-47438346 AAAGGAAGGAAGGAAGGAAGAGG + Intergenic
1096320766 12:50610884-50610906 AACTGCTTGAACGGAGGCAGAGG - Intronic
1096460087 12:51817561-51817583 AAATGAATGCATGGAGGAAGGGG - Intergenic
1096809353 12:54159697-54159719 AAAGGAAAGGAGGGAGGGAGGGG + Intergenic
1096821482 12:54239074-54239096 ATAGGAATGTAGGGAGCCAGAGG - Exonic
1097237822 12:57551704-57551726 AAAGGAATGAAGGAAAGAAGGGG + Intronic
1097458537 12:59832059-59832081 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
1097684665 12:62680269-62680291 AAAGGAAGGAAGGGAGGGAGGGG - Intronic
1098075746 12:66728903-66728925 AAAGAAAGGAAGGGAGGAAGGGG - Intronic
1098216075 12:68221310-68221332 AAAGGAATGAAGGAAGGAAAAGG + Intronic
1098504809 12:71237273-71237295 GAATGAATGAAGGGAGGAAGTGG + Intronic
1101146037 12:101841240-101841262 AAAGGAAGGAAGGGAGAGAGAGG + Intergenic
1101805269 12:108057860-108057882 AAAGGAATGAGTGGAGGTAGAGG + Intergenic
1102544179 12:113642716-113642738 GAAGGAAAGAAGGGAGGGAGGGG - Intergenic
1102640007 12:114358853-114358875 AAAGGAATCAAGGGAGGAGGTGG - Intronic
1102864075 12:116360407-116360429 GAAGGAAGGAAGGGAGGAAGCGG - Intergenic
1103016745 12:117500625-117500647 AATGGAAGGAACAGAGGCTGAGG + Intronic
1103314495 12:120041610-120041632 AAAGGAATGGAGGGCGGCACAGG + Intronic
1103758036 12:123225525-123225547 AAAGGAAGGGAGGGAGGGAGGGG + Intronic
1104691103 12:130827058-130827080 AAAGGAAGGGAGGGAGGGAGGGG + Intronic
1104928681 12:132327191-132327213 AAAAGAAAGAAAGGAGGAAGGGG + Intronic
1105438936 13:20400037-20400059 AAAGGACTGTCCGGAGGCTGGGG - Intergenic
1105545192 13:21346088-21346110 AAATGAAGAAACGGAGGCATTGG + Intergenic
1106879832 13:34117053-34117075 AGTGGAGTGAAGGGAGGCAGTGG - Intergenic
1107186399 13:37526914-37526936 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
1107728997 13:43329284-43329306 AAAGGAATGAATTAAGGCAGAGG + Intronic
1107784428 13:43940741-43940763 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1108213033 13:48157461-48157483 AAAGGAAAGGACAGAGTCAGAGG - Intergenic
1108794759 13:54017790-54017812 AAAGGAGGGAAGGGAGGCAAGGG + Intergenic
1108822356 13:54368717-54368739 GAAGGAAAGAAGGGAGGGAGGGG + Intergenic
1109107059 13:58266802-58266824 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
1109299379 13:60575127-60575149 AGAAGAAAGAAGGGAGGCAGAGG + Intergenic
1111452657 13:88438858-88438880 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
1111589267 13:90322813-90322835 AGAGGGATGAGCAGAGGCAGAGG + Intergenic
1111604956 13:90525497-90525519 AAAAGAAAGAATGGAGGGAGTGG + Intergenic
1112317548 13:98377013-98377035 AAAGAAATGAATGGGTGCAGTGG + Intronic
1114202073 14:20530926-20530948 AAAGGAAGGAAGGAAGGAAGGGG + Intergenic
1115385094 14:32788412-32788434 AAAGGAATGAAAAGGGGCAAGGG + Intronic
1115389923 14:32842766-32842788 AAAGGAAGGAAGGAAGGAAGGGG + Intergenic
1116024592 14:39499558-39499580 AAAGGATTTAATAGAGGCAGGGG + Intergenic
1116290019 14:43022494-43022516 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1116307544 14:43277584-43277606 AAAAGAATCAATTGAGGCAGAGG + Intergenic
1116365833 14:44061810-44061832 AAAGGAATGAGCAAAGGCTGTGG + Intergenic
1116856416 14:49956131-49956153 AAATGAATGAATGGAGGCCGGGG - Intergenic
1116857299 14:49964020-49964042 GAAGGAATGAAAGGACACAGGGG - Intergenic
1117128660 14:52661068-52661090 AAATGAATGATCAGAGGCTGAGG + Intronic
1117497465 14:56319861-56319883 AAAGGGAGGAAAGGAGGGAGAGG - Intergenic
1117573456 14:57073336-57073358 AAAGGAATGAGAGGAAGGAGAGG + Intergenic
1120040042 14:79742421-79742443 AAAGGCAAGAAGGGAGGGAGGGG - Intronic
1120876684 14:89381876-89381898 AAAGGGAGGGACGGAGGGAGGGG + Intronic
1121042692 14:90761859-90761881 AAAGGGCTGAACCAAGGCAGGGG - Intronic
1121066240 14:90968511-90968533 TAAGGAATGAATAGAGGCTGTGG - Intronic
1121489828 14:94349831-94349853 AAAGGGAGGAAGGGAGGGAGGGG - Intergenic
1121607320 14:95250768-95250790 CAAAGAATGAACGAATGCAGGGG + Intronic
1122766384 14:104074039-104074061 AAAGGAATGAAAGGGCCCAGCGG - Intergenic
1125582346 15:40795254-40795276 AAAGGAAGGAAGGGAGGAAGGGG + Intronic
1125657836 15:41372798-41372820 AAAGGATTGGCCGGACGCAGTGG + Intronic
1125680425 15:41527088-41527110 AAAGGGAGGAAGGGAGGCTGTGG + Intronic
1126415931 15:48417437-48417459 GAAGGAAGGAAAGGAGGGAGGGG - Intronic
1126468086 15:48979014-48979036 AAACATATGAATGGAGGCAGGGG + Intergenic
1126846680 15:52766737-52766759 AAAGGAAAGAGCGGGAGCAGAGG + Intronic
1127586420 15:60382177-60382199 GAAGGAAGGAAAGGAGGCATGGG + Intronic
1127630503 15:60823061-60823083 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
1127911073 15:63416718-63416740 GAAGGAAGGAAAGGAGGAAGGGG + Intergenic
1129141243 15:73599643-73599665 AAAGGAAGGGAGGGAGGGAGGGG + Intronic
1129668413 15:77592646-77592668 AAAGGCAGGGAGGGAGGCAGAGG + Intergenic
1130209093 15:81906850-81906872 AAAGAAATGAGGGGAGGGAGTGG + Intergenic
1130747167 15:86667680-86667702 AAAGGAAGGAAAGGAGGATGAGG - Intronic
1131269210 15:90936107-90936129 AAAGGAAAGGCCCGAGGCAGTGG - Intronic
1131913164 15:97231539-97231561 AAAGGAAGGAAGGGAGGGAAGGG + Intergenic
1132027091 15:98412792-98412814 AGAGGAAGGAAGGGAGGGAGCGG + Intergenic
1132380345 15:101361833-101361855 AGGGGACTGAACTGAGGCAGTGG + Intronic
1133035992 16:3034692-3034714 AAAGGAAGGAAGGAAGGAAGGGG - Intronic
1133244150 16:4436190-4436212 AATGGAATGAACAGAGGCATGGG + Intronic
1133333144 16:4988599-4988621 GAAGGAAGGAAAGGAGGGAGGGG - Intronic
1133589552 16:7229551-7229573 AGAGGAAGGAAGGGAGGGAGGGG + Intronic
1133589687 16:7230061-7230083 AGAGGAAGGAAGGGAGGGAGGGG + Intronic
1133901376 16:9978480-9978502 AGAGGAATGAGAGGAGGAAGAGG - Intronic
1134084130 16:11345243-11345265 TTAGGAATGAACGGAGGAAATGG - Intronic
1134108189 16:11499040-11499062 AAACGAGTGAAAGGAGGAAGGGG + Intronic
1134351796 16:13444464-13444486 GAAGGAAAGAAGGGAGGAAGGGG + Intergenic
1134509519 16:14834782-14834804 AAAGGGATGGATGGAGGTAGGGG + Intronic
1134697224 16:16233598-16233620 AAAGGGATGGATGGAGGTAGGGG + Intronic
1134881380 16:17747541-17747563 AAAGGAAAGAAAGGAAGGAGGGG + Intergenic
1134974622 16:18561076-18561098 AAAGGGATGGATGGAGGTAGGGG - Intronic
1135553408 16:23415806-23415828 AAGGGTATTAAGGGAGGCAGGGG - Intronic
1135628967 16:24021284-24021306 GAAGGAAGGAAGGGAGGGAGAGG - Intronic
1135939530 16:26809475-26809497 AAAGGAAGGAAGGAAGGAAGAGG + Intergenic
1136037842 16:27554002-27554024 GAAGGAAAGAAGGGAGGGAGAGG + Intronic
1136343356 16:29659723-29659745 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1136579761 16:31144131-31144153 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
1137517123 16:49156164-49156186 AAAGCAATGAGGGGAGGCAGAGG + Intergenic
1137864013 16:51875244-51875266 AAAGGAATGAAGAAAGGAAGAGG + Intergenic
1138970220 16:62134359-62134381 AGAGGAATGAAAGGAGGCTTTGG - Intergenic
1139272471 16:65697170-65697192 AAATGAATTAACAAAGGCAGTGG + Intergenic
1140009878 16:71120677-71120699 AAACGAAGGAAAGGAGGTAGAGG - Intronic
1140125378 16:72113659-72113681 AGAGGGAAGAATGGAGGCAGAGG - Intronic
1140382455 16:74502628-74502650 AAAGGCATGAACCCAGGAAGTGG - Intronic
1140837777 16:78811425-78811447 AAAGGAAGAAAGGGAGGAAGAGG - Intronic
1141235266 16:82210098-82210120 AAAGGAAGGAAGGAAGGAAGAGG - Intergenic
1141773044 16:86102433-86102455 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
1141810975 16:86375448-86375470 AAAAGCATGAACATAGGCAGAGG - Intergenic
1142135035 16:88448000-88448022 GAAGGAAGGAAAGGAGGGAGAGG + Intergenic
1142444658 16:90128393-90128415 AAAGTAATGAAGCAAGGCAGAGG + Intergenic
1142462853 17:107072-107094 AAAGTAATGAAGCAAGGCAGAGG - Intergenic
1142638046 17:1270110-1270132 ATAGGAATAAAAAGAGGCAGAGG - Intergenic
1142656445 17:1397738-1397760 AAAGGAATGGACACAGGTAGAGG + Intronic
1142822889 17:2485976-2485998 AAAGGAAGGAACGAAGGGAAGGG + Intronic
1143231669 17:5361224-5361246 TAAGGAATGAACTGAGCCACGGG - Exonic
1143399215 17:6631096-6631118 GAATGAATGAAGGGAGGAAGAGG + Intronic
1146826982 17:36031610-36031632 AAAAGACTGAACTAAGGCAGGGG - Intergenic
1147610204 17:41797533-41797555 AAATGAATGAAGGGAGGCAGGGG - Intergenic
1147958919 17:44154340-44154362 ATAAAAAAGAACGGAGGCAGGGG + Intronic
1148487806 17:48002390-48002412 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
1148673643 17:49432087-49432109 TAAAGAAGGAAGGGAGGCAGGGG + Intronic
1149446654 17:56718434-56718456 AAAGGAATAAAGAGAGGCAATGG + Intergenic
1149674096 17:58443293-58443315 AAAGGACTGATCAGATGCAGTGG - Intronic
1150572707 17:66401639-66401661 TAAGGAATGAACTAGGGCAGTGG + Intronic
1150902606 17:69298272-69298294 GAAGGAAGGAAGGGAGGGAGGGG + Intronic
1150919532 17:69468653-69468675 AGAGGAATGAAGGGAGCCAGGGG + Intronic
1151752554 17:76048536-76048558 AGATGAAGGAACGGAAGCAGAGG + Intronic
1151918458 17:77136326-77136348 AAAGGAAGGAAGGGAGGGAAGGG - Intronic
1152472743 17:80499419-80499441 AAAGGAAGGAAGGAAGGCGGAGG - Intergenic
1152949420 17:83219821-83219843 AAAGGGAGGAAAGGAGGCAGCGG - Intergenic
1153026871 18:680369-680391 AAAGGGAGAAACGGAGGAAGGGG + Intronic
1153366757 18:4265467-4265489 AAAGGAAGGAAGGAAGGAAGGGG - Intronic
1153366771 18:4265543-4265565 AAAGGAAGGAAGGAAGGAAGGGG - Intronic
1153483165 18:5567649-5567671 AAAGGAAGGAAGGAAGGGAGGGG + Intronic
1153538134 18:6125179-6125201 AAAGGAAGGAAGGAAGGGAGGGG + Intronic
1153691520 18:7599500-7599522 AAAGCAAGGAACTGAGTCAGGGG - Intronic
1154024261 18:10692439-10692461 AAAGGGAGGGAGGGAGGCAGGGG - Intronic
1154391204 18:13937793-13937815 AAAAGAATGAACGAAGACAGAGG - Intergenic
1155184705 18:23376949-23376971 AAAGGAATAAAAGGAGGGTGGGG + Intronic
1155922166 18:31614258-31614280 AAAGGAAAGAAGGGAGAGAGAGG + Intergenic
1156189724 18:34704271-34704293 AAAGGAAGGAAGGGAGAAAGTGG + Intronic
1156480177 18:37431343-37431365 AAAGGAAAGAAAGGAGAAAGTGG - Intronic
1156783817 18:40884097-40884119 AAAGGAATGAAAGGAAAAAGAGG - Intergenic
1157183124 18:45515460-45515482 AAAGGAATCAACAGAACCAGTGG + Intronic
1157234486 18:45951543-45951565 AATGGCATGAACGCAGGAAGCGG - Intronic
1157448327 18:47765212-47765234 GAAGGAAGGAAAGGAGGGAGAGG + Intergenic
1158153131 18:54394500-54394522 AAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1158674543 18:59506464-59506486 AAAGGAATGAAGGGAGGGAGAGG + Intronic
1158696365 18:59707623-59707645 AAAAGAATGAATGAAGGTAGTGG - Intergenic
1158869272 18:61668744-61668766 AAAAGAAGGAACAGAGACAGGGG + Intergenic
1158890266 18:61866031-61866053 ATAAGAATGAACCCAGGCAGTGG - Intronic
1159302431 18:66592533-66592555 AAAGGAAAGAATGGAAGAAGAGG - Intronic
1159594103 18:70366183-70366205 AAAGCAAAGAATAGAGGCAGGGG - Intergenic
1159687335 18:71438609-71438631 GTAGCAATGAAGGGAGGCAGAGG + Intergenic
1160041650 18:75351002-75351024 AGGGGAAGCAACGGAGGCAGGGG + Intergenic
1160181020 18:76636308-76636330 ACAGAAAGGAACTGAGGCAGCGG - Intergenic
1160356116 18:78229598-78229620 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1160566974 18:79792334-79792356 AAAGTAATGAACAGAGGAGGAGG + Intergenic
1160652557 19:239447-239469 AAAGTAATGAAGCAAGGCAGAGG - Intergenic
1161133319 19:2604670-2604692 GAAGGAAGGAAGGGAGGGAGTGG + Intronic
1161638570 19:5405212-5405234 CAAGGGATGATGGGAGGCAGAGG - Intergenic
1162049958 19:8027055-8027077 AGAGGAAGGAACTGAGGCTGGGG + Intronic
1162310067 19:9900979-9901001 GAAGGAAGGAAGGGAGGGAGGGG + Intronic
1162649746 19:12078840-12078862 AAAGAAATGAACGGGGAGAGAGG - Exonic
1162796918 19:13091871-13091893 AAAGAAAGTAAAGGAGGCAGCGG - Intronic
1163011646 19:14430379-14430401 AGAGGAAGGAAGGGAGGGAGGGG - Intergenic
1163351999 19:16782954-16782976 GAAGGAAAGAAGGGAGGAAGGGG - Intronic
1163471471 19:17499830-17499852 GAAGGGAGGAACGGAGGAAGGGG + Intronic
1164426051 19:28142696-28142718 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
1164732766 19:30518840-30518862 AAAGGAGTGAACCAGGGCAGAGG + Intronic
1165089983 19:33380877-33380899 AAATGAATAAACAGAAGCAGTGG - Exonic
1165768551 19:38365266-38365288 AAAAGAATGAAAGGAGTTAGTGG - Intronic
1165910292 19:39221822-39221844 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
1165954940 19:39496621-39496643 AAAGGAATTAAAGAAGGGAGTGG + Intergenic
1166418991 19:42619950-42619972 AAATGAATGAGTGGAGGCTGGGG + Intronic
1166648079 19:44547572-44547594 AGAGGAAGGAAGGGAGGGAGGGG + Intergenic
1167389951 19:49188552-49188574 AAGGGAAGGAACAGAGTCAGAGG - Intronic
1168053203 19:53845543-53845565 GAAGGAAGGAAAGGAGGGAGGGG - Intergenic
1168177030 19:54633609-54633631 AAAAGAATGAGAGGAGGCTGAGG - Intronic
1168330526 19:55565151-55565173 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
1168615795 19:57835949-57835971 AAAGGACTGATTGGAGGCTGAGG + Intronic
925004908 2:434827-434849 AAAGGAAGGAAAGGAAGGAGAGG - Intergenic
926115886 2:10213147-10213169 GAAGGAAAGAAGGGAGGGAGGGG + Intergenic
926194195 2:10752270-10752292 AAAGCAAAGGAAGGAGGCAGAGG - Intronic
926244684 2:11113865-11113887 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
926323006 2:11762102-11762124 AAAGGAATGAACGCGAGGAGGGG - Intronic
926368223 2:12153196-12153218 AAAGGAATGAAGGGAAGGAAGGG - Intergenic
926534382 2:14092658-14092680 AAAGGAAAGAAGGAAGGAAGGGG + Intergenic
926669398 2:15561824-15561846 AATGGAATGAGCAGAGACAGAGG + Intergenic
927060655 2:19416370-19416392 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
927107704 2:19842051-19842073 AAAGGAAGGGAAGGAGGGAGGGG + Intergenic
927540357 2:23904848-23904870 AAAGGAATGCACAGAGGCAGTGG + Intronic
928112420 2:28521650-28521672 AAAGGGATGAACAGAGAAAGAGG + Intronic
928605554 2:32942443-32942465 AGAGGAATGAATGGAGAAAGGGG - Intergenic
929233745 2:39585635-39585657 ACAGGAACCCACGGAGGCAGGGG - Intergenic
929683107 2:44011299-44011321 AAAAGAGTGAATGGAAGCAGAGG - Intergenic
932428619 2:71659813-71659835 AGAGGAAAGAAGAGAGGCAGGGG + Intronic
932812705 2:74837613-74837635 AGAGGAATGAAAGGATGGAGAGG - Intronic
933059968 2:77725135-77725157 AAAGGAAGGAAGGGAGGGAAGGG + Intergenic
933380837 2:81542171-81542193 AATGGAATCAAGGGAGGAAGAGG - Intergenic
934903039 2:98176246-98176268 AAAGGAAGGAAGGAAGGGAGGGG - Intronic
935131304 2:100263130-100263152 GAAGGAAGGAAAGGAGGGAGGGG - Intergenic
935191495 2:100782087-100782109 GAAGGGAGGAACGGAGGGAGGGG - Intergenic
935811687 2:106804549-106804571 AAAGGAATGACCGGGCGCGGTGG + Exonic
936894210 2:117408051-117408073 GAAGGAAGGAACGAAGGAAGGGG - Intergenic
937625094 2:124035011-124035033 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
937786065 2:125900021-125900043 AACAGAATGAACCAAGGCAGGGG + Intergenic
938774242 2:134527330-134527352 AGAGGAAGGAAGGGAGGAAGGGG + Intronic
939046399 2:137255575-137255597 AAGGGAAGTAAAGGAGGCAGTGG - Intronic
939415722 2:141894371-141894393 GAAGGAATGGAAGGAGGGAGGGG - Intronic
939733897 2:145819454-145819476 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
939848185 2:147273106-147273128 AAAGGTATTATGGGAGGCAGAGG + Intergenic
939857085 2:147371534-147371556 AAAGGAAGGAAAGGAGAAAGAGG + Intergenic
939858892 2:147394086-147394108 AAAGGAGTGAATGGTGGGAGTGG - Intergenic
939870820 2:147524016-147524038 GAAGGAAGGAAAGGAGGAAGTGG + Intergenic
939880734 2:147628248-147628270 AAATGAAGGAACTGAGACAGAGG - Intergenic
940115986 2:150208944-150208966 AAAGGAGCTAACGGAGACAGGGG - Intergenic
940179695 2:150918474-150918496 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
940702929 2:157068947-157068969 AAAGAAAGGAAGGAAGGCAGTGG - Intergenic
942216186 2:173720991-173721013 AAAGGAAAGGAGGGGGGCAGGGG + Intergenic
942661069 2:178265782-178265804 AAAGGAAGGAAAGAAGGTAGAGG - Intronic
943180977 2:184540515-184540537 AAAGGAAGGAAGGAAGGGAGGGG + Intergenic
943477417 2:188375762-188375784 AAATGAAAGAAGGAAGGCAGGGG + Intronic
944285703 2:197947641-197947663 AATGTAATGAATGGAGACAGTGG + Intronic
944914308 2:204341935-204341957 AAAGGAAGGAAGGGAGGGAGGGG + Intergenic
944926190 2:204467569-204467591 AAAGAAATGAAAGGAAGGAGAGG + Intergenic
945590632 2:211725824-211725846 AAAGGAAGGAAGGAAGGAAGGGG + Intronic
945638932 2:212397492-212397514 AAAGGAAGGAAGGAAGGAAGGGG + Intronic
945693972 2:213079456-213079478 GAAGGAAGGAAAGGAGGGAGGGG + Intronic
946510861 2:220354821-220354843 TAAGGAATGAAAGGATGCACTGG + Intergenic
947042789 2:225942559-225942581 GAAGGAATGAAGGGAGAGAGAGG + Intergenic
947661226 2:231870032-231870054 AAAGGAAGGGAGGGAGGGAGAGG - Intergenic
948191792 2:236064794-236064816 GAAGGAATGAACTGAGAAAGAGG + Intronic
948369114 2:237476030-237476052 AGAGGACTGAAGGGAGGCATGGG - Intergenic
949048054 2:241881348-241881370 AAAGGAAGGGGCGGAGGAAGCGG - Intergenic
1169001749 20:2172915-2172937 GAAGGAAGGAAGGGAGGGAGGGG + Intronic
1169507886 20:6232949-6232971 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1169918819 20:10711417-10711439 ATAGGAATAAATGGAGGCAGAGG + Intergenic
1170129135 20:13000246-13000268 GAAGTAATGAGCGGAGGCACAGG + Intergenic
1170502317 20:16987470-16987492 ATAGCAATGAAGGGAGGCAAAGG - Intergenic
1170758099 20:19222774-19222796 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
1171197670 20:23212991-23213013 AAAGGAATGAAGGTATGAAGTGG - Intergenic
1171213275 20:23333614-23333636 AAAAGAAAGAAAGGAGGCACTGG - Intergenic
1171366658 20:24629474-24629496 AGAGGAAAGGAGGGAGGCAGAGG + Intronic
1172057519 20:32164878-32164900 AGAGGAATGAATGGAGGCTGAGG + Intronic
1173146742 20:40531300-40531322 AAAGGAAGGAAGGGAGGGAGAGG + Intergenic
1173437459 20:43045863-43045885 AAAGGGATGAAAGGAGGCAGGGG + Intronic
1173775551 20:45703408-45703430 AAAGGAATGAATGAAGAAAGAGG - Intronic
1173894880 20:46543137-46543159 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
1174062695 20:47843906-47843928 AAAGGAAGGAAGGAAGGAAGGGG + Intergenic
1174434572 20:50496916-50496938 AGAGGAATGCAGGAAGGCAGTGG + Intergenic
1174983076 20:55419491-55419513 AAAGGGAAGAAAGGAGGAAGAGG - Intergenic
1175051701 20:56161490-56161512 AAAGGAAAGCAGAGAGGCAGAGG + Intergenic
1175058850 20:56222945-56222967 AAATAAATTAACAGAGGCAGGGG + Intergenic
1175615008 20:60390504-60390526 GAAGGAATGAAGGGAAGAAGGGG - Intergenic
1176782273 21:13211127-13211149 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
1177347979 21:19898858-19898880 GAAGGAATGAAGGGAGGGAGGGG - Intergenic
1177537795 21:22451553-22451575 GAAGGAAGGAAGGGAGGAAGGGG - Intergenic
1178177272 21:30117352-30117374 AAAGGAAGGAAGGAAGGAAGGGG + Intergenic
1178257511 21:31067865-31067887 AAAGGAATGTGGGAAGGCAGGGG - Intergenic
1178585610 21:33868398-33868420 ACAGGAACCCACGGAGGCAGGGG + Intronic
1178708344 21:34891448-34891470 AAATGAATGGAAAGAGGCAGGGG + Intronic
1179061455 21:37983154-37983176 GAAGGAAGGAAAGGAGGGAGGGG - Intronic
1179081657 21:38176904-38176926 AAAGGAATAAAAGGAAGAAGAGG + Intronic
1179178703 21:39027179-39027201 AAATCAATGGATGGAGGCAGAGG - Intergenic
1179352149 21:40621956-40621978 GAAGGAAAGAAAGGAGGGAGGGG + Intronic
1179508375 21:41856282-41856304 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
1179628875 21:42664662-42664684 AAAGGAAGGGAGGGAGGGAGGGG + Intronic
1181737474 22:24893059-24893081 AAAGGAAGGAAGGAAGGAAGCGG + Intronic
1181868200 22:25876113-25876135 AAAGGAAGGAGAGGAGGCAGAGG - Intronic
1182456334 22:30453400-30453422 AAATAAATGAAAGGAGGCTGTGG - Intronic
1182809282 22:33102472-33102494 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
1183162808 22:36126396-36126418 GAAGGAAGGAAAGGAGGGAGAGG - Intergenic
1183162828 22:36126462-36126484 GAAGGAATGAAAGGAGGGAGAGG - Intergenic
1183162885 22:36126704-36126726 GAAGGAAGGAAAGGAGGGAGAGG - Intergenic
1183162891 22:36126726-36126748 GAAGGAAGGAAAGGAGGGAGAGG - Intergenic
1183162897 22:36126748-36126770 GAAGGAAGGAAAGGAGGGAGAGG - Intergenic
1183597140 22:38819408-38819430 AAGTGAAGGAACAGAGGCAGGGG - Exonic
1184210855 22:43034895-43034917 AAAGGAAAGAAAGGGGGGAGGGG + Intergenic
1184534842 22:45079307-45079329 AAAGCAATCAATGGTGGCAGTGG + Intergenic
1203248953 22_KI270733v1_random:97662-97684 AAAGGAAGGAATGAAGGAAGAGG - Intergenic
949954284 3:9254895-9254917 AAAGGAAGGAAGGAAGGGAGGGG + Intronic
950225359 3:11229094-11229116 AAAGGAAGGGAGGGAGGCAGAGG - Intronic
950574021 3:13820275-13820297 GAAAGAATGAATGGAGGAAGGGG + Intronic
951595933 3:24318063-24318085 AAAGGAAGGAAGGAAGGAAGGGG + Intronic
951616918 3:24557322-24557344 AAGGGAAAGAATGGAAGCAGAGG - Intergenic
951627209 3:24678806-24678828 AAACGAATGAACCGAAGCGGGGG + Intergenic
951930558 3:27962338-27962360 CAGGGAAGGAATGGAGGCAGAGG + Intergenic
951955128 3:28244832-28244854 AAAGGAAGGAATGGAAGCAATGG + Intronic
952312836 3:32205861-32205883 AGAGGAATGGAAGGAGGTAGAGG - Intergenic
952561126 3:34594769-34594791 AAAGGAAATAGTGGAGGCAGAGG - Intergenic
953836561 3:46351252-46351274 AAAGGAATAAATGGAGGTAAAGG + Intergenic
955118099 3:56026038-56026060 AAAGAAAGAAACGGAGGAAGGGG - Intronic
955166223 3:56516532-56516554 AAAGGAAAGAAGGGAGGAAAGGG + Intergenic
956190297 3:66601740-66601762 AAAGGAAGGAAGGGGGGGAGGGG - Intergenic
956526480 3:70168288-70168310 AAGGGAATTAAGGGAGGAAGGGG + Intergenic
956536669 3:70284595-70284617 CAAGGACTGAATGGAGCCAGAGG + Intergenic
956627979 3:71285746-71285768 AAAGGAAGGAACTGATGTAGTGG + Intronic
957015338 3:75056534-75056556 AAAGGAAAGCAGGAAGGCAGAGG + Intergenic
958099869 3:88995363-88995385 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
958732572 3:97974489-97974511 AAAGGAAGGAAAGAAGGAAGGGG + Intergenic
959096895 3:101965990-101966012 AAAAGAATAATCTGAGGCAGAGG - Intergenic
959097537 3:101971948-101971970 AAAAGAATAATCTGAGGCAGAGG - Intergenic
959176324 3:102916426-102916448 ACAGGAATGAGCTGAGGCAGAGG - Intergenic
959190050 3:103099593-103099615 AAAGGAAGGAAAGAAGGAAGGGG - Intergenic
959256839 3:104025815-104025837 GAAGGAAGGAAGGAAGGCAGGGG + Intergenic
959504197 3:107139949-107139971 AAAGAAATGGACAGTGGCAGTGG - Intergenic
960029571 3:113043617-113043639 AAAGGAAAGGACAGAGGAAGAGG - Intergenic
960333421 3:116390540-116390562 AAAGGAATGCAAGTAGGCAATGG + Intronic
961524469 3:127487731-127487753 AAGGGAATGAAAGGGGGCAATGG + Intergenic
962213857 3:133502777-133502799 AAAGGAAGGAAGGAAGGAAGAGG + Intergenic
962340093 3:134575275-134575297 AAAGGGAGGAAGGGAGGGAGGGG - Intergenic
963337086 3:143987799-143987821 TAAGGAATGAATAGAGGCTGAGG - Intronic
963350196 3:144142050-144142072 AGAGGAAGGAAAGGAGGGAGAGG - Intergenic
964322789 3:155515700-155515722 AGAGCTATGAACGGAGGCTGGGG - Intronic
964581856 3:158248041-158248063 AGAGGAATGAAAGGGGCCAGTGG - Intronic
964835087 3:160929471-160929493 AAAGGAAGGAAAAGAGGGAGAGG + Intronic
965171050 3:165265473-165265495 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
965502459 3:169472704-169472726 AAAGGAAGAAAGGGAGGGAGGGG + Intronic
966101584 3:176275584-176275606 AAAGGAAGGAAGGAAGGAAGGGG + Intergenic
966249248 3:177844142-177844164 AAAGGTATGATCAGAGGGAGAGG + Intergenic
966402547 3:179562704-179562726 GAGGGAATGGGCGGAGGCAGTGG - Intergenic
967251682 3:187546591-187546613 AAAGGAAGGAAAGGGTGCAGTGG - Intergenic
967337543 3:188361450-188361472 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
967350679 3:188511052-188511074 AAAGAAAGGAAAGGAGGGAGAGG - Intronic
967801045 3:193660232-193660254 AAAGGAATGAACAGGGGTGGAGG - Intronic
968056838 3:195698183-195698205 CAAGGAATGCTCGGAGGGAGGGG - Intergenic
968206911 3:196811250-196811272 AAGGGAAGGAAGGGAGGGAGGGG - Intronic
968365276 3:198180525-198180547 AAAGTAATGAAGCAAGGCAGAGG + Intergenic
969068445 4:4510239-4510261 AAAGCAATGGAGGAAGGCAGAGG + Intronic
969228956 4:5816581-5816603 TAAGGAAAGAAGGGAGGGAGGGG - Intronic
969353794 4:6613583-6613605 GAAGGAAGGAAGGGAGGGAGGGG + Intronic
969516770 4:7652450-7652472 GGAGGAATGAATGGAGCCAGGGG - Intronic
969577923 4:8047213-8047235 AAAGGAAGGAGAGGAGGGAGTGG + Intronic
969705663 4:8789814-8789836 AAAGGAAGGCACGGGGCCAGAGG + Intergenic
970755676 4:19422918-19422940 AAAAGAAAGAAAGGAGGGAGGGG + Intergenic
970808582 4:20064490-20064512 AAAGGGATGAAGGGATACAGAGG + Intergenic
971240404 4:24883440-24883462 AAAGGAACGAAGAGAGGCACAGG + Intronic
971361989 4:25946614-25946636 AAAGGAAAGGAAGTAGGCAGAGG + Intergenic
971919449 4:32917924-32917946 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
972323609 4:37994634-37994656 AAATGCATGAACAGAGGCTGGGG - Intronic
972415777 4:38839083-38839105 GAAGGAAGGAAGGGAGGGAGGGG + Intronic
972513701 4:39793511-39793533 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
972723209 4:41721570-41721592 ATATGAATCAACAGAGGCAGTGG + Intergenic
973653862 4:53025105-53025127 AATGGAATGAACAGAAGAAGGGG + Intronic
973765352 4:54157130-54157152 AAAGGAAGGAAGGAAGGAAGGGG + Intronic
974880907 4:67756281-67756303 AGAGGAATGAAAGGAGGAAAAGG - Intergenic
975177398 4:71303767-71303789 AAAGGAAAAAAGGGAGGGAGGGG - Intronic
975455924 4:74589533-74589555 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
975558907 4:75691366-75691388 AAATGAATAAATGAAGGCAGTGG - Intronic
975755908 4:77570943-77570965 ACAGGAACCCACGGAGGCAGAGG - Intronic
977128886 4:93208336-93208358 AAATGAATAAACTGAGGCACAGG - Intronic
977385397 4:96332943-96332965 AAAGGATAAAACAGAGGCAGAGG - Intergenic
977483356 4:97608371-97608393 AGAGGAATGAACAGTGGCACAGG + Intronic
977593357 4:98850988-98851010 AAAGGAAGGAAGGGAGGGAAGGG + Intergenic
977748988 4:100585681-100585703 AAAAGAATGAAGGGAGAAAGAGG + Intronic
978071618 4:104479751-104479773 GAAGGAAGGAAGGGAGGGAGAGG - Intronic
978130903 4:105196151-105196173 AAAAAAAAGAACAGAGGCAGAGG - Intronic
978392665 4:108243353-108243375 AAAGGACTGAGCAAAGGCAGTGG + Intergenic
978581174 4:110232669-110232691 AAAGGAATGAACTAATTCAGTGG + Intergenic
978625539 4:110680731-110680753 AAAGGACTGAACTAAGGCAATGG + Intergenic
979250067 4:118558171-118558193 AGATGAAGGAACTGAGGCAGCGG + Intergenic
979254311 4:118595683-118595705 AAAGTAATGAAGCAAGGCAGAGG + Intergenic
979849538 4:125559517-125559539 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
980806925 4:137827710-137827732 GAAGGAAGGAAGGGAGGAAGGGG + Intergenic
980928667 4:139164026-139164048 AAGAGAAGGAAGGGAGGCAGGGG + Intronic
981544302 4:145878670-145878692 AAAGGAAGGAAGGGAGAGAGAGG + Intronic
983309869 4:166045803-166045825 AAAGCAAAGATCTGAGGCAGCGG - Intronic
983844473 4:172499877-172499899 AAAGAAATGAACGTAGGCATAGG + Intronic
984612409 4:181856174-181856196 AAGGGAAGGAAGGGAGGGAGGGG + Intergenic
984863115 4:184257313-184257335 GAAGGAAGGAAGGCAGGCAGTGG + Intergenic
984867899 4:184298505-184298527 AAAGGAACAAAGGGAGCCAGGGG + Intergenic
985022468 4:185706523-185706545 GAAGGAAGGAAAGGAGGGAGGGG - Intronic
985212696 4:187612220-187612242 TAAGGAATGAAGAGAGGCAGGGG + Intergenic
985817621 5:2138290-2138312 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
986142410 5:5043411-5043433 AAAGGAAGGAAGGAAGGGAGGGG + Intergenic
986490731 5:8286927-8286949 GAAGGAAGGAAGGGAGGGAGAGG - Intergenic
987037406 5:14032151-14032173 TAAGGAATGGACGGATGCATTGG - Intergenic
987075848 5:14381098-14381120 GAAGGAATGAATGGAGTCAGAGG - Intronic
988206097 5:28137086-28137108 AAGGGAATGAACAGCAGCAGGGG - Intergenic
988287296 5:29236811-29236833 CAAGGAATGAAGGGATGAAGGGG - Intergenic
988623649 5:32848462-32848484 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
989714158 5:44440416-44440438 AAAGGAAAGAAAGGAAGGAGGGG + Intergenic
989981931 5:50655733-50655755 AAAGGAAGGAAGGAAGGGAGGGG - Intergenic
990049973 5:51485497-51485519 AAAGCAATGAATGGAGACATGGG + Intergenic
991777604 5:70100226-70100248 AAAAAAATAAAGGGAGGCAGTGG - Intergenic
991856892 5:70975670-70975692 AAAAAAATAAAGGGAGGCAGTGG - Intronic
992372997 5:76164258-76164280 AAAGGTATCAAAGGAGCCAGGGG - Intronic
992705440 5:79386927-79386949 AAAGGAAGGAAGGAAGGGAGGGG - Intronic
993831909 5:92770718-92770740 AAAGGAAGGAAGGAAGGAAGGGG + Intergenic
994327814 5:98469376-98469398 AAGGGAATAAAAGCAGGCAGTGG - Intergenic
995266129 5:110163233-110163255 AAAGGAATGGAGTGAGGCAGGGG + Intergenic
995299015 5:110556358-110556380 AAAGGAAGGAAGGAAGGAAGGGG - Intronic
995767274 5:115632557-115632579 AAAGGAAGGAAGGGAGGGAAGGG + Intronic
996877171 5:128252471-128252493 GAATGAATGAAGGGAGGGAGAGG - Intergenic
997111667 5:131081938-131081960 AAAGGAATGAATTGAGGCGGAGG - Intergenic
997225731 5:132208346-132208368 AAAGGAAGGGAGGGAGGGAGGGG + Intronic
997744596 5:136288120-136288142 AAAGGAAGAAACTGAGGCAGAGG + Intronic
998283719 5:140837614-140837636 AAAGGAAGGAAGGAAGGAAGGGG - Intronic
998305578 5:141072846-141072868 AAAGGAAGGAAGGAAGGAAGGGG + Intergenic
998534115 5:142913419-142913441 GAAGGAAAGGAAGGAGGCAGGGG - Intronic
999301397 5:150492877-150492899 GAGGGAATGAATGCAGGCAGAGG - Intronic
999796462 5:154993804-154993826 GAAGGAAAGAAGGGAGGGAGGGG - Intergenic
999823590 5:155252945-155252967 AAACGAAGGAACTGAGCCAGTGG + Intergenic
1000051372 5:157565756-157565778 AAAGGAATAAATGGAGGCACAGG + Intronic
1000775307 5:165412898-165412920 ATAGGAAAGGACGGGGGCAGTGG + Intergenic
1000903723 5:166937700-166937722 AAAGGAAGGGAGGGAGGGAGAGG + Intergenic
1001108349 5:168875060-168875082 GAAGGAAAGAAGGGAGGAAGAGG + Intronic
1001622141 5:173096374-173096396 AAGGGAGGGAAGGGAGGCAGGGG - Intronic
1001750457 5:174126432-174126454 AAAGGAAGGAAGAGAGACAGAGG - Intronic
1001919390 5:175588563-175588585 AAAGGAAGGGAGGGAGGGAGAGG + Intergenic
1002743651 5:181453636-181453658 AAAGGGAGGAAAGGAGGCAGCGG - Intergenic
1002777417 6:341008-341030 AAAGGAAGGGACCCAGGCAGAGG + Intronic
1002805851 6:573342-573364 AAAAGAAAGAAGGGAGACAGAGG - Intronic
1003403717 6:5811181-5811203 ACACTAATGAAGGGAGGCAGTGG + Intergenic
1003851392 6:10226341-10226363 GAAGGAAGGAAAGGAGGGAGGGG + Intergenic
1004423173 6:15489351-15489373 GCAGGAATGAAGGGTGGCAGAGG + Intronic
1004482651 6:16035585-16035607 AAAGGAAGGAAGGAAGGAAGGGG + Intergenic
1004766521 6:18734318-18734340 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1004784605 6:18953093-18953115 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
1005601827 6:27433963-27433985 GAAGGAAGGAAGGGAGGGAGAGG - Intergenic
1005986757 6:30880797-30880819 AAGGAGATGAAGGGAGGCAGAGG - Intronic
1006213156 6:32414519-32414541 AAAGGGAGGAAGGGAGGGAGGGG + Intergenic
1008087332 6:47258724-47258746 AAAGGAAATAAAGGATGCAGTGG - Intronic
1008209707 6:48705342-48705364 GAAGGAAAGAAGGGAGGGAGGGG + Intergenic
1008347982 6:50453106-50453128 AAAGAAAAGAAAGGAGGGAGAGG + Intergenic
1008514835 6:52309061-52309083 AAAGCAGGGAACTGAGGCAGAGG + Intergenic
1009707709 6:67276049-67276071 AAAGGAGTTCAAGGAGGCAGAGG - Intergenic
1010572480 6:77494633-77494655 AAAGGAAGAAACTGAGGCACAGG - Intergenic
1010813545 6:80327923-80327945 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
1011895984 6:92226091-92226113 AATAGAATCAACGGAGCCAGAGG - Intergenic
1012371804 6:98516356-98516378 AAATGAATGAACAGATGCATGGG - Intergenic
1013082735 6:106826763-106826785 AGAGGAAGGAAGGGAGGGAGGGG + Intergenic
1014718598 6:124892254-124892276 ACAGGAACCCACGGAGGCAGGGG - Intergenic
1015965079 6:138689961-138689983 AAGGGAAGGAACACAGGCAGTGG + Intronic
1016402372 6:143694232-143694254 AAAGGAAGGAAGGGAGGGAAAGG + Intronic
1016547327 6:145239025-145239047 GAAGGAAAGAAGGGAGGGAGGGG - Intergenic
1017067188 6:150539948-150539970 AAGGGAAAGAACCGAGGCAAAGG + Intergenic
1017238253 6:152139588-152139610 GAAGGAAGGAAGGGAGGGAGGGG + Intronic
1017623048 6:156318316-156318338 ACATGAAAGAACAGAGGCAGTGG + Intergenic
1017689082 6:156945368-156945390 AATGGTATGCACTGAGGCAGTGG + Intronic
1017781478 6:157718899-157718921 GAAGGGAAGAAGGGAGGCAGAGG + Intronic
1018030688 6:159838778-159838800 AAATGAATGAGTGGAGGAAGAGG + Intergenic
1018211050 6:161481900-161481922 GAAGGAAGGAAGGGAGGGAGGGG + Intronic
1018211765 6:161489134-161489156 AAAGGAAGGAAGGGAGGGATAGG - Intronic
1018270580 6:162073151-162073173 AAATGAATGAATGGAGCAAGGGG + Intronic
1018595056 6:165470195-165470217 AGAGGAAGCAAGGGAGGCAGTGG + Intronic
1018642757 6:165919586-165919608 AAAGAAAGGAAAGGAGGAAGAGG - Intronic
1018838669 6:167503729-167503751 GAAGGGATGGAGGGAGGCAGTGG - Intergenic
1019248509 6:170726865-170726887 AAAGGGAGGAAAGGAGGCAGCGG - Intergenic
1019250916 7:10379-10401 AAAGTAATGAAGCAAGGCAGAGG - Intergenic
1019728646 7:2617385-2617407 AAAGGAATGAAAGCAGGGAAGGG + Intergenic
1019830304 7:3321752-3321774 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
1020042041 7:5011613-5011635 AAAGGAAGGAAGGAAGGTAGAGG + Intronic
1020081030 7:5285627-5285649 AAGGGAGTAAACTGAGGCAGGGG + Intronic
1020803219 7:12757450-12757472 AAGTGAATGAGAGGAGGCAGTGG + Intergenic
1020823174 7:12996082-12996104 AAAGAAAGGAAGGGAGGAAGGGG - Intergenic
1020866728 7:13573845-13573867 AAAGAAATAAAAGGAGGCATTGG - Intergenic
1021552650 7:21888106-21888128 AAATGAATGAAGTGAGGCACAGG - Intronic
1022234657 7:28449359-28449381 AAAGTAATGAGAGAAGGCAGAGG - Intronic
1022254688 7:28644087-28644109 AAAGGAAGGAAGGGAGGGAGGGG + Intronic
1022466288 7:30655085-30655107 AAAGGAGGGAAAGGAGGGAGTGG + Intronic
1022495322 7:30849629-30849651 TAAGGAATCAGCGGAGGCAGAGG - Intronic
1023230277 7:38020577-38020599 AAAGGAAGGAAGGAAGGAAGGGG - Intronic
1023283035 7:38591254-38591276 AAAGAAAAGAAAGGAGGCATTGG - Intronic
1023403886 7:39811728-39811750 GAAGGAAGGAAGGGAGGAAGAGG + Intergenic
1023565713 7:41522044-41522066 AAAGAAAGGAATGGAGGAAGAGG + Intergenic
1023647148 7:42329990-42330012 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1023724900 7:43132777-43132799 GAAGGAAGGAACAGAGGAAGGGG - Intronic
1023793418 7:43771592-43771614 AAGGGAGTGAACAGAGGAAGGGG - Intronic
1024079923 7:45847782-45847804 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1024368900 7:48558124-48558146 AAAGGAAGGAAGGAAGGAAGGGG - Intronic
1024574769 7:50754744-50754766 AAAGGCCTGAAGGGAGGCTGGGG - Intronic
1025197881 7:56946539-56946561 AAGGGAGTAAACTGAGGCAGGGG - Intergenic
1025674067 7:63630396-63630418 AAGGGAGTAAACTGAGGCAGGGG + Intergenic
1026253487 7:68691027-68691049 AAAGGAAGGAAGGAAGGAAGAGG + Intergenic
1026596523 7:71738159-71738181 ACAGGAACCAACGGAGGCAGGGG + Intergenic
1026677165 7:72437731-72437753 AAAGGAAGGAAGGGTGGGAGGGG - Intronic
1026809974 7:73455277-73455299 AAAGGAAAGAAGGCAGGGAGAGG + Intronic
1027711174 7:81603275-81603297 AAAGGAATGAAAGTAGACAAAGG + Intergenic
1029087020 7:98019769-98019791 AAGGGAAGGAAGGGAGGGAGCGG - Intergenic
1029530182 7:101120323-101120345 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
1029575817 7:101402636-101402658 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
1029646586 7:101860726-101860748 GAAGGAAGGAAGGGAGGAAGGGG - Intronic
1029795867 7:102893890-102893912 AGAGGAAGGAAGGGAGGGAGGGG + Intronic
1031750677 7:125569271-125569293 GAAGGAACGAAGGGAGGGAGGGG - Intergenic
1031895187 7:127340184-127340206 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1032037055 7:128529263-128529285 AAAGCACTCAACGGAGTCAGAGG - Intergenic
1032479155 7:132232737-132232759 AGAGGAATGAAGGAAGGAAGGGG + Intronic
1032675850 7:134129217-134129239 AAAGGAAGGAAGGGAGAGAGGGG - Intronic
1033062028 7:138118776-138118798 AAAGGAAGGAAGGGAGGGAGGGG + Intergenic
1033131868 7:138751676-138751698 TAAGGAATGAATGGAGGGAGCGG + Intronic
1033710139 7:143934470-143934492 AAAACAAAGAAAGGAGGCAGAGG - Intergenic
1033719532 7:144043280-144043302 ACAGGATAGAACGTAGGCAGAGG + Intergenic
1033994621 7:147330305-147330327 AAAGGCATGATGGGAGGCACCGG - Intronic
1034045496 7:147923085-147923107 AAAGGAAGGAAGGAAGGGAGGGG + Intronic
1034111524 7:148542238-148542260 AAAGGAAGGAAGGGAGGGAAGGG + Intergenic
1034111544 7:148542310-148542332 AAAGGAAGGAAGGAAGGAAGGGG + Intergenic
1034272550 7:149810350-149810372 AAAGGAAGGAACTGAGGCACGGG - Intergenic
1034424673 7:151008213-151008235 ATAGGAAGGAAGGGAGGGAGGGG + Intronic
1034439619 7:151080068-151080090 AAAGGCGTGGAAGGAGGCAGAGG - Intronic
1034757402 7:153635551-153635573 GAAGGAAAGAAGGGAGGGAGGGG - Intergenic
1034815947 7:154172123-154172145 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
1035499537 8:80470-80492 AAAGGGAGGAAAGGAGGCAGCGG + Intergenic
1035770430 8:2142744-2142766 AAAAGAATAAAGGGAGGGAGGGG - Intronic
1035820563 8:2587353-2587375 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1036704074 8:11033628-11033650 AGAGCAATGAAGGGAAGCAGAGG - Intronic
1036978901 8:13446591-13446613 CAAGGAAGGAACGGAGGGAAGGG + Intronic
1037908491 8:22729313-22729335 AAAGGAATAAGGGGAGGCTGAGG - Intronic
1038329861 8:26599581-26599603 AAAGAAAGGAAAGGAGGAAGTGG - Intronic
1038573664 8:28685416-28685438 GAAGGAAGGAAAGGAGGAAGAGG - Intronic
1038601460 8:28947456-28947478 AAAGGAAGAAAAGAAGGCAGAGG - Intronic
1038806202 8:30794487-30794509 AAAGGAAGGGAGGGAGGGAGGGG - Intronic
1039562693 8:38525869-38525891 AAAGGAAGGAAGGAAGGAAGGGG - Intronic
1039717293 8:40123508-40123530 GAAGGAATGAAGGGAGGGAGGGG + Intergenic
1039939804 8:42080383-42080405 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1040083822 8:43317920-43317942 AAAGCAATGATCACAGGCAGTGG + Intergenic
1040869361 8:52084235-52084257 GAAGGAAAGAAGGGAGGGAGGGG + Intergenic
1040980431 8:53241411-53241433 AAAAGAAAGGAGGGAGGCAGAGG + Intronic
1042694038 8:71536092-71536114 AAAGGATGGTAGGGAGGCAGGGG + Intronic
1043461964 8:80469082-80469104 AAAGAAAAGAAGGGAGGAAGGGG - Intergenic
1043792529 8:84490576-84490598 GAAGGAAAGAAGGAAGGCAGGGG + Intronic
1044449369 8:92315841-92315863 AAAGGAAAGAACTGAGGAAATGG - Intergenic
1044542151 8:93420073-93420095 AAAAGAAGGAAAGGAGGAAGAGG - Intergenic
1045155269 8:99462077-99462099 GAAGGAAGGAAGGGAGGGAGGGG - Intronic
1045285724 8:100789541-100789563 AGAGGACTGAACTAAGGCAGTGG + Intergenic
1046029777 8:108769451-108769473 AGAGAAAAGAACAGAGGCAGAGG - Intronic
1046236285 8:111427992-111428014 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1047278352 8:123423345-123423367 AAAGGAAGGAAAGGAGGGAAAGG - Intronic
1047481238 8:125285424-125285446 AAAAGAAGGAAGGGAGGGAGGGG - Intronic
1047555117 8:125920902-125920924 AAAGGAAGGGAAGGAGGGAGGGG + Intergenic
1047559877 8:125975306-125975328 AACTGAATGAACAGAGGCAGTGG + Intergenic
1048569861 8:135643221-135643243 GAAGGAATGGACAGAGGCAATGG - Intronic
1050246997 9:3701061-3701083 AAAGGAATGAAGGCAGGCAGAGG - Intergenic
1052610810 9:30771206-30771228 AAGGGAATGACCAGAGGGAGAGG + Intergenic
1053037813 9:34840490-34840512 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1053042607 9:34887454-34887476 AAAGGAATAAAGGGAGAAAGTGG - Intergenic
1053153816 9:35760033-35760055 AAAGGGATCAAAGGAGGCTGAGG - Intergenic
1053516524 9:38735061-38735083 AAAAGAAGGAAGGGAGGGAGAGG - Intergenic
1053562356 9:39209681-39209703 GAAGGAAGGAAGGGAGGAAGGGG - Intronic
1053828160 9:42047669-42047691 GAAGGAAGGAAGGGAGGAAGGGG - Intronic
1054602398 9:67139781-67139803 GAAGGAAGGAAGGGAGGAAGGGG + Intergenic
1054716423 9:68561613-68561635 GAAGGGAGGAAGGGAGGCAGTGG - Intergenic
1054847325 9:69810671-69810693 AAAGGAAGGAAAGTAGGGAGAGG - Intergenic
1055654365 9:78438550-78438572 AAAGGATTGAAAGGGGGGAGGGG - Intergenic
1056056469 9:82828989-82829011 AAAGGAATGGAAGGAGGCAGAGG + Intergenic
1056189822 9:84173803-84173825 AAAGGAAGGAAGAGAGGGAGAGG + Intergenic
1056523931 9:87425283-87425305 AAAGGAAGGAGGGGAGGGAGAGG + Intergenic
1057590112 9:96365417-96365439 CTAGGAATGAACTGTGGCAGAGG + Intronic
1057911448 9:99023123-99023145 AAAGGCAGGAAAGGAGGCCGAGG + Intronic
1057995386 9:99818728-99818750 AAAGGAAGGAACGGATGTAAAGG + Intergenic
1058401730 9:104626869-104626891 AAAAGAATAAATGGAAGCAGGGG - Intergenic
1059117547 9:111613142-111613164 AAAAGACTGAAAGGAGGCAAGGG - Intergenic
1059352932 9:113678413-113678435 AAAGGAAGGAAGGGAGGGAAAGG - Intergenic
1059541723 9:115137037-115137059 AAAGGGAAGAAAGGAGGCAGTGG + Intergenic
1059792453 9:117654789-117654811 CAAGGGATGAACGGTGGCACTGG - Intergenic
1059987566 9:119835370-119835392 AGAGGAATGAAGGAAGGGAGAGG + Intergenic
1059987579 9:119835416-119835438 AGAGGAATGAAGGAAGGGAGAGG + Intergenic
1061313610 9:129779947-129779969 AAAGGAAAGAAGGAAGGCAGGGG + Intergenic
1061330777 9:129890854-129890876 AAAGTAAGAAACGGAGGCCGGGG + Intronic
1061884206 9:133583466-133583488 AGAGGAGGGAACTGAGGCAGAGG - Intronic
1062695088 9:137870698-137870720 GAAGGAAGGAAGGGAGGGAGGGG - Intergenic
1062749645 9:138243390-138243412 AAAGTAATGAAGCAAGGCAGAGG + Intergenic
1203609469 Un_KI270748v1:84129-84151 AAAGGGAGGAAAGGAGGCAGCGG - Intergenic
1185517064 X:708124-708146 AAAGAAAGGAAGGGAGGGAGAGG - Intergenic
1185659028 X:1711987-1712009 AAAGGAAGGGAGGGAGGGAGGGG - Intergenic
1185667371 X:1776663-1776685 AAAGGAAGGAAAGGAAGCAAAGG - Intergenic
1185708639 X:2283883-2283905 AAAGGAATGAACGAATTCAAAGG - Intronic
1185803248 X:3032414-3032436 AAAGGAAGGAAGGAAGGAAGGGG + Intronic
1185822452 X:3218584-3218606 AAAGGAATAAAGAGAGGGAGAGG + Intergenic
1185869240 X:3649837-3649859 GAAGGAAGGAAGGGAGGGAGAGG + Intronic
1186013621 X:5166238-5166260 AAATAAATAAACAGAGGCAGAGG + Intergenic
1187231775 X:17430194-17430216 CAAGGAAGGAAGGGAGGGAGGGG - Intronic
1187968908 X:24640051-24640073 AAAGGAACGAAAGAAGGAAGGGG + Intronic
1188428515 X:30077276-30077298 AAAGTAAGGATAGGAGGCAGTGG - Intergenic
1189520731 X:41764615-41764637 AAAGGAAGTAAAGGAGGAAGAGG - Intronic
1189778060 X:44487854-44487876 AAAGGAAAGAAGGGAGGGAGGGG + Intergenic
1190332585 X:49245009-49245031 AAAGAAATGGACAGAGGGAGAGG - Intronic
1192341157 X:70264390-70264412 AAAGGTAGGAAGGGAGGGAGAGG + Intergenic
1193677677 X:84476577-84476599 AAAGGAAGGAAGGAAGGAAGGGG + Intronic
1194375575 X:93128737-93128759 AAAGGAGTGAAGGGAAGGAGAGG - Intergenic
1194479046 X:94397344-94397366 AAAGGATTGACCGGGTGCAGTGG - Intergenic
1194650012 X:96503338-96503360 AAAGGAAGGGAGGGAGGGAGTGG + Intergenic
1196068128 X:111488318-111488340 AAAGGAAGGAAGGAAGGGAGAGG - Intergenic
1196433614 X:115654355-115654377 AAAGGAATGGCCGGGTGCAGTGG - Intergenic
1196439539 X:115705775-115705797 GAAGGAAGGAAGGGAGGGAGAGG - Intergenic
1196819019 X:119688227-119688249 TCAGCAATGAATGGAGGCAGAGG - Intronic
1196904134 X:120415668-120415690 AAAGAAAGGAAGGGAGGAAGGGG - Intergenic
1197177380 X:123500353-123500375 AAAGCAATGAAGGGAGGCTATGG + Intergenic
1197647735 X:129036202-129036224 AAAGGAGGGAAAGAAGGCAGTGG + Intergenic
1197810075 X:130433500-130433522 AAAGGAAAGAAAGGAGGGAGGGG - Intergenic
1198041730 X:132859649-132859671 GAAGGAAGGAAGGGAGGAAGAGG + Intronic
1198069969 X:133138567-133138589 AAAAGAAAGGAGGGAGGCAGAGG + Intergenic
1198121111 X:133593369-133593391 AAAGAAATAAACATAGGCAGTGG + Intronic
1198229140 X:134673160-134673182 AAAGGAAAGAAGGAAGACAGGGG + Intronic
1198279760 X:135130112-135130134 AAAGGAATAAAGGCAGCCAGGGG - Intergenic
1198291197 X:135242402-135242424 AAAGGAATAAAGGCAGCCAGGGG + Intergenic
1198478560 X:137018986-137019008 GAAGGAAGGAAGGGAGGGAGGGG + Intergenic
1198752333 X:139948576-139948598 AAAGGAAGGAAGGAAGGAAGGGG - Intergenic
1199867322 X:151863909-151863931 AAAGGAACAAACAGAGGGAGTGG - Intergenic
1201146109 Y:11066529-11066551 AAAGGAAGGAAGGGAGGGAGAGG + Intergenic
1201146157 Y:11066666-11066688 AGAGGAAGGAAGGGAGGGAGAGG + Intergenic
1201146242 Y:11066952-11066974 AGAGGAAGGAAGGGAGGGAGAGG + Intergenic
1201146525 Y:11067851-11067873 AGAGGAATGGAAGGAGGGAGAGG + Intergenic
1201146538 Y:11067887-11067909 AGAGGAAGGAAGGGAGGGAGAGG + Intergenic
1201573058 Y:15434123-15434145 ACAGGAATGCATGGAGGCGGGGG - Intergenic