ID: 900458560

View in Genome Browser
Species Human (GRCh38)
Location 1:2789400-2789422
Sequence TTTTACAAAGGAATGAACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 744
Summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 671}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900458560_900458567 21 Left 900458560 1:2789400-2789422 CCTCCGTTCATTCCTTTGTAAAA 0: 1
1: 0
2: 5
3: 67
4: 671
Right 900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 43
900458560_900458565 10 Left 900458560 1:2789400-2789422 CCTCCGTTCATTCCTTTGTAAAA 0: 1
1: 0
2: 5
3: 67
4: 671
Right 900458565 1:2789433-2789455 CACATCCGTCGCTACCTCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 23
900458560_900458569 30 Left 900458560 1:2789400-2789422 CCTCCGTTCATTCCTTTGTAAAA 0: 1
1: 0
2: 5
3: 67
4: 671
Right 900458569 1:2789453-2789475 AGGAGACCCGCAGGAAGCAGCGG 0: 1
1: 0
2: 0
3: 30
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900458560 Original CRISPR TTTTACAAAGGAATGAACGG AGG (reversed) Intronic
900458560 1:2789400-2789422 TTTTACAAAGGAATGAACGGAGG - Intronic
901265871 1:7910283-7910305 TTTTACAAAGAAAGGCAGGGTGG - Intergenic
901664035 1:10816399-10816421 TTTTACAGATGAAGAAACGGAGG - Intergenic
901787615 1:11635209-11635231 TTTTACGAGGGAGAGAACGGAGG - Intergenic
901866891 1:12112254-12112276 TTTTACAGAGGAGGAAACGGAGG + Intronic
902083467 1:13837713-13837735 TTCTATAAAGGAAGGAAGGGAGG - Intergenic
902743297 1:18455490-18455512 TTTTACAAATGAAGAAACTGAGG + Intergenic
902995355 1:20220840-20220862 TTTTACAGAGGAGGGAACTGAGG + Intergenic
903230129 1:21916849-21916871 TTTTACAAAGGAGGAAACTGAGG + Intronic
903470084 1:23580746-23580768 CTTTACAAAGGAAGAAACTGAGG - Intergenic
903703899 1:25270754-25270776 TATTACAAATGAGTGAACTGAGG - Intronic
904134050 1:28297357-28297379 TTTTACAAAAGAATAAACCAAGG + Intergenic
904476499 1:30768508-30768530 TTTTACAAAGGAGTAAACTGAGG - Intergenic
904510050 1:30997511-30997533 TTTTTTAAAGGAAAGAAAGGAGG + Intronic
904541210 1:31234593-31234615 TTTTACAAAGGAAGAAACTGTGG + Intronic
904632727 1:31854932-31854954 TTTCACAAGGGAATGAAGGGTGG - Intergenic
904874761 1:33645759-33645781 TTTTATAAAGGAAGAAATGGAGG + Intronic
905451053 1:38056612-38056634 TTTTACAAATGAAGAAACTGAGG + Intergenic
905453953 1:38074898-38074920 TTTTACAAATGAAGAAACTGGGG + Intergenic
905493302 1:38362182-38362204 TTTTACCAATGAAGGAACTGAGG + Intergenic
905518433 1:38578981-38579003 TTTTATAGAGGAGTAAACGGAGG - Intergenic
905964841 1:42083105-42083127 TGATACAAAGGATTGAAGGGAGG - Intergenic
905967713 1:42113224-42113246 TTTCCCAAAGGAGTGAACTGGGG - Intergenic
906290444 1:44616455-44616477 TTTTACAGAGGAAGAAACTGAGG + Intronic
906680506 1:47722914-47722936 TTTTACAATGGGGTAAACGGAGG + Intergenic
906855523 1:49300329-49300351 TTTTACCAATTAATGAACAGAGG - Intronic
907550895 1:55303925-55303947 TTTTACAAATGAAGAAACTGAGG - Intergenic
907575906 1:55525335-55525357 TTTTACAGATGAATAAACTGAGG - Intergenic
907643710 1:56219385-56219407 TTTTACAAATGAAGAAACTGAGG + Intergenic
907710937 1:56880840-56880862 TTTTACAAATGACTAAACCGAGG + Intronic
907724341 1:57004861-57004883 CTTTACAAATGAAGGAACTGGGG - Intronic
907854149 1:58284719-58284741 TTTTACAAAGGGATAAACTGAGG + Intronic
908312476 1:62899003-62899025 TTTTACAGAGGAAGAAACTGAGG - Intergenic
908562708 1:65323174-65323196 TTTTACAAAGGAGGAAACTGAGG - Intronic
908608313 1:65825371-65825393 TTTAGCAAAGGAATGAACCCTGG + Intronic
908784205 1:67718987-67719009 TTTTACAAACGAAGAAACTGAGG + Intronic
908847771 1:68342526-68342548 TTTTACAAAGCAATAAATTGAGG + Intergenic
909168706 1:72264262-72264284 TTTTACAAATGAATAAACACAGG - Intronic
909574898 1:77162976-77162998 TTTTACAAGTGAGTGAACTGAGG - Intronic
909774380 1:79465405-79465427 TTTTACACATGAATGACCTGAGG - Intergenic
910057146 1:83046469-83046491 TTTTAGAAATGAAGGAACTGAGG + Intergenic
910203072 1:84719948-84719970 TTTTAAAAAGGCACGAATGGAGG - Intergenic
910466168 1:87502609-87502631 TTTTACAGAGGAAGAAACAGAGG - Intergenic
910525274 1:88170799-88170821 TTTTACAGATGAAGAAACGGAGG - Intergenic
911142167 1:94516189-94516211 TTATACAAAGGAAGCAACTGAGG - Intronic
911263365 1:95713826-95713848 CTTTAAAAAGGAAGGAAGGGAGG - Intergenic
912157559 1:106940603-106940625 TTATACAGATGAATGAACTGAGG - Intergenic
912760635 1:112363498-112363520 TTTTAAAAAGGAATGAAAGGTGG + Intergenic
912807627 1:112770500-112770522 TTTTACAAATGAAAAAACAGAGG + Intergenic
913170064 1:116223787-116223809 TTTTACAAATGAAGAAACTGAGG - Intergenic
913351220 1:117862010-117862032 TTTTACAAATGAAGAAATGGAGG - Intergenic
915846033 1:159266186-159266208 TTTTACAAATGAAGAAACTGAGG + Intergenic
916121401 1:161531395-161531417 GTTTACAAAGGAAGGAAGGGAGG - Intergenic
916131170 1:161612975-161612997 GTTTACAAAGGAAGGAAGGGAGG - Intronic
916429650 1:164714968-164714990 TTTTACAGATGAATAAACAGTGG - Intronic
916493541 1:165324772-165324794 TTTTACAAATGAAGAAACTGAGG + Intronic
916710511 1:167401841-167401863 GTTTACAAAGGTATGGATGGAGG - Intronic
917217764 1:172695893-172695915 TTTTACAAATGAAGAAACTGAGG + Intergenic
918280720 1:183002345-183002367 TTTTACAAATGAAAGAATGGAGG + Intergenic
919361300 1:196598744-196598766 TTTTACAAATGAATCAACCAAGG - Intronic
919932916 1:202233237-202233259 TTTGACAAAGGAAAGGATGGAGG + Intronic
920226326 1:204441866-204441888 TTTTACAGAGGAGTAAACTGAGG - Intronic
920432578 1:205928229-205928251 TTTTACAAAGGAGGAAACTGAGG + Intronic
921215060 1:212929573-212929595 TTTTACAAAAGAAGAAACTGAGG - Intergenic
922119928 1:222655701-222655723 TTTTAAAAAGTAATGAAATGAGG - Intronic
922184474 1:223261928-223261950 TTTTACAGAGGAAGAAATGGAGG + Intronic
922273516 1:224055988-224056010 TTTTACAAATGAAGAAACTGAGG + Intergenic
923018122 1:230142497-230142519 TTTTACAAAGGAGGAAACAGAGG - Intronic
923050772 1:230389951-230389973 TTTTATAAAGGAGGAAACGGAGG + Intronic
923418480 1:233789129-233789151 TTTTACAAATGAAGAAACTGAGG - Intergenic
923501664 1:234570486-234570508 TTTCACAAAGGAAGAAACTGAGG + Intergenic
923581586 1:235221208-235221230 TTTTACAAATGAAGAAACTGAGG + Intronic
924122545 1:240816825-240816847 TTTTACATAGGAATTAAATGGGG + Intronic
924750257 1:246880938-246880960 TTTTAATAAGGAATGCATGGGGG + Intronic
1064146500 10:12830287-12830309 TTTTCCAAGGGAAGGAAGGGAGG + Exonic
1064318508 10:14279920-14279942 TTTTACAAATGAGTAAACTGAGG + Intronic
1064615655 10:17152940-17152962 TTTCATAATGGAATGAAAGGGGG - Intronic
1065045649 10:21745900-21745922 TTTTATAAAAAAATGAAAGGAGG - Intergenic
1065462952 10:25988690-25988712 TTTTATAAATGAATAAACAGTGG + Intronic
1065609944 10:27463014-27463036 TTTTACAGATGAAGGAATGGAGG - Intergenic
1065750645 10:28883531-28883553 TTTGACAAAGGAAAGGACAGAGG - Intergenic
1065772284 10:29088614-29088636 TTTTAAAAAAAAATGAAAGGAGG - Intergenic
1066051087 10:31636268-31636290 TTTTACAAACTAGTGAATGGAGG + Intergenic
1066463235 10:35630767-35630789 TTTTACAAAGGAGGAAACTGAGG + Intergenic
1067543994 10:47178729-47178751 TTTTACAGAGGAAGAAACTGAGG - Intergenic
1067830438 10:49608742-49608764 TTTTACAAAGAAACTAACTGAGG + Intergenic
1068486304 10:57663499-57663521 TATTACAGAGGAAGGAAGGGAGG + Intergenic
1068867252 10:61907441-61907463 TTTTACAGAGGAAGAAACAGAGG - Intronic
1068887401 10:62111654-62111676 TTTTACAGACGAAGGAACAGAGG + Intergenic
1069713918 10:70508670-70508692 TTTTACAAAGGAGGAAACTGGGG - Intronic
1069883271 10:71607401-71607423 TTTTACAGAGGAAGAAACTGAGG - Intronic
1069914499 10:71779189-71779211 TTTCACAGAGGAAGGAACTGAGG + Intronic
1069980939 10:72252151-72252173 TTTTACAAAGCAAGAAACTGAGG - Intergenic
1069981249 10:72254352-72254374 TTTTACAAAGCAAGAAACTGAGG - Intergenic
1070694830 10:78554491-78554513 TTTTTCAAAGGAAGAAACTGAGG + Intergenic
1071693847 10:87851514-87851536 TTTTACAAATGAAGAAACTGAGG - Intergenic
1071781380 10:88849575-88849597 TTTTACAAATGAAGAAACTGAGG - Intronic
1072499157 10:95994742-95994764 TATAACCAAGGAATGACCGGCGG - Intronic
1073050511 10:100664109-100664131 TTTTACAGAGGAGTAAACTGAGG - Intergenic
1076078817 10:127559399-127559421 TTATACAAGAGAATGAACGCAGG + Intergenic
1076823504 10:132954834-132954856 TTTTACACAAGAATGGACGCTGG - Intergenic
1077209440 11:1362012-1362034 TTTGACAAAGGGATGGACGATGG + Intergenic
1078412753 11:11141056-11141078 TTTTACAAACGAAGAAACTGAGG + Intergenic
1078594881 11:12677095-12677117 CTTTATAAAGTAATGAACTGCGG + Intronic
1079107415 11:17580325-17580347 TTTTACAAATGAAGGAGCTGAGG - Intronic
1079761481 11:24334944-24334966 TTTTCCAAATGACTGAACTGGGG + Intergenic
1080501530 11:32876036-32876058 TTTTACAAAGGAGGAAACTGAGG + Intergenic
1080539022 11:33248968-33248990 TTTTACAGATGAAAGAACAGAGG - Intergenic
1080627632 11:34044900-34044922 TTTTAAAAAGTAATCAAAGGCGG - Intergenic
1080748720 11:35132566-35132588 TTTTACAAAAGAGTAAACAGTGG - Intergenic
1080804723 11:35642030-35642052 TTTTACAAATGAAGGAACTGAGG + Intergenic
1080890485 11:36404856-36404878 TTTTACAAAGGAGGAAACTGAGG + Intronic
1081007922 11:37771579-37771601 TTTCACAAAGAAATGAACAAAGG + Intergenic
1081372293 11:42318726-42318748 TTTTTGAAGGAAATGAACGGGGG - Intergenic
1081534507 11:43987321-43987343 CTTTCCAAAGGAACAAACGGAGG - Intergenic
1081859290 11:46323299-46323321 TTTTACAAATGAAGAAATGGGGG - Intergenic
1082215866 11:49568566-49568588 TTTTACAGAGAAAAGAACTGAGG - Intergenic
1082934005 11:58637967-58637989 ATTTTCAAAGAAATGAACTGAGG + Intergenic
1083716497 11:64580351-64580373 TTTTACAGAGGAGGAAACGGAGG + Intergenic
1083963374 11:66026885-66026907 TTTTACAGAGGAAGAAACTGAGG - Intergenic
1084012297 11:66359160-66359182 TTTTACAGATGAATAAACTGAGG - Intronic
1084434835 11:69132605-69132627 TTTTACAGATGAGTAAACGGAGG - Intergenic
1084456802 11:69272683-69272705 TTTTACACAGGAAGAAACTGAGG - Intergenic
1084703869 11:70804661-70804683 TTCAACAAAGGAAAGAAGGGAGG - Intronic
1084901337 11:72312132-72312154 TTTTATAGAGGAAGAAACGGAGG - Intronic
1085416274 11:76321090-76321112 TTTTACAGAGGAATAAAGTGAGG + Intergenic
1085497218 11:76980807-76980829 TTTTACAAACGAAGGAACAAAGG - Intronic
1085642105 11:78199183-78199205 TTTTACAGAGGAAGAAACTGAGG + Intronic
1085698830 11:78728572-78728594 TTTTAGAAAGGAAGGAAGTGGGG - Intronic
1085770263 11:79319110-79319132 TTTTACAGATGAAGAAACGGAGG + Intronic
1086048707 11:82563861-82563883 TTTTACAAAGGGAGAAACTGAGG + Intergenic
1086130011 11:83391469-83391491 TGCCACAAAGGAATGAAGGGAGG - Intergenic
1086633713 11:89055906-89055928 TTTTACAGAGAAAAGAACTGAGG + Intronic
1086879462 11:92136733-92136755 GTTTTCAAAGGCATGAAAGGAGG - Intergenic
1086982527 11:93214758-93214780 TTTTACAAATGAACAAACTGAGG + Intergenic
1087589203 11:100163933-100163955 TTTTACAAATGAAAGAATTGAGG + Intronic
1087663858 11:101019589-101019611 TTCTACAAAGGAATGAACCTGGG + Intergenic
1088876083 11:113937593-113937615 TTTTACAAATAAATGAATTGAGG + Intronic
1088994818 11:114987132-114987154 TTTTGCAAATGAAGGAACTGAGG + Intergenic
1089747743 11:120628873-120628895 TTTTAAAAAGGAAGGAAGGGAGG - Intronic
1089801991 11:121039564-121039586 TTTTAAAAATAAATGAATGGGGG + Intronic
1090183642 11:124721899-124721921 TGTTACAAAGGAAAAAACTGTGG - Intergenic
1090224289 11:125060507-125060529 TTTTACAGAGGAGGGAACTGAGG + Intergenic
1090353797 11:126125561-126125583 CTTTACAAATAAATGAACTGAGG + Intergenic
1090500921 11:127260063-127260085 TTTTACAAATGAAGAAACTGGGG + Intergenic
1091042657 11:132296526-132296548 TTTTACTAAGGAGGGAACTGAGG + Intronic
1091131784 11:133152725-133152747 ATTTATAAAGGAATGAAGGGAGG - Intronic
1091325555 11:134684343-134684365 TTTAACAAATAAATAAACGGAGG - Intergenic
1091457475 12:618519-618541 TTTTACAGAGGAAGAAACTGAGG + Intronic
1091737509 12:2935220-2935242 TTGGACAAAGGAATGACAGGAGG - Intronic
1091800916 12:3323997-3324019 TTCTACAGAGGAAGGAACTGAGG + Intergenic
1091876651 12:3940084-3940106 TTTTACAAAGGAGGAAACTGAGG - Intergenic
1092021507 12:5206627-5206649 TAATACAAAGGAATGAATGCTGG - Intergenic
1093284283 12:17239317-17239339 TTTTACAAATGATAGAACTGAGG + Intergenic
1093837427 12:23851771-23851793 TTTTACAAAGGTATTATCAGTGG - Intronic
1094068096 12:26382914-26382936 TTTTACAAATGAAGAAACTGAGG + Intronic
1094139098 12:27162296-27162318 TTTTACAAAGGAGGAAACTGAGG + Intergenic
1094372520 12:29753512-29753534 TTTTACAAAGGAGAAAACAGAGG - Intronic
1095375574 12:41524391-41524413 TTTTACATATGAAAGAACTGAGG + Intronic
1095730738 12:45504334-45504356 TTTTACAAATGAAGAAACTGAGG + Intergenic
1095969005 12:47888692-47888714 TTTTACAACTGAAGAAACGGAGG + Intronic
1096238402 12:49945149-49945171 TTTTACAAAGGAGGAAACTGAGG - Intergenic
1096974185 12:55689312-55689334 TTTTTCAAAGGAAGAAACTGAGG + Intronic
1097327167 12:58289897-58289919 TTTTACAAAGGTATTAAATGTGG + Intergenic
1098068440 12:66645466-66645488 TTTTACAAAGGGATTAACTTTGG + Intronic
1098561952 12:71884432-71884454 TTTTACAAATGAAGTAACTGAGG + Intronic
1099195103 12:79606824-79606846 TTTTACAAATGAGTAAACTGAGG - Intronic
1099296890 12:80839333-80839355 TTTTACAAATGAAGAAACTGAGG - Intronic
1099700012 12:86072149-86072171 TTTTACAGATGATAGAACGGAGG + Intronic
1100190286 12:92183529-92183551 TTTTAAAAATGAAAGAACTGAGG + Intergenic
1100458252 12:94773733-94773755 TTTTACAGAGGAAGAAACTGAGG + Intergenic
1100726527 12:97414606-97414628 TTTGACAAAGAAAGGAAGGGAGG - Intergenic
1100812925 12:98357513-98357535 TTTTACAGATGAATAAACTGAGG - Intergenic
1101060284 12:100963972-100963994 TTTTACAAATGAAGAAACTGAGG + Intronic
1101295951 12:103424047-103424069 TTTGGCAAATGAATGAATGGAGG + Intronic
1101450168 12:104768828-104768850 TTTTACAAATGGATCAACTGAGG + Intergenic
1101656808 12:106729597-106729619 TTTTACAAAGGAAGAAAGTGAGG - Intronic
1101693178 12:107100029-107100051 TGTTACAATGGATTAAACGGAGG + Intergenic
1101735159 12:107457958-107457980 TTTTACAAAGGAAGAAACTGAGG - Intronic
1101860786 12:108480837-108480859 TTTTACAGAGGAAGAAACGGGGG + Intergenic
1101894577 12:108746296-108746318 TTTTACAGAGGAAGAAACTGAGG + Intergenic
1101918391 12:108913441-108913463 TTTTACAAAGGAGAAAACTGAGG + Intronic
1101957524 12:109224050-109224072 TCTTACAGAGGAAGGAACTGAGG + Intronic
1102028068 12:109724683-109724705 TTTTACAGAGGAAGAAACTGAGG - Intronic
1102078460 12:110078822-110078844 ATTTAAAAAGTAATGAACGCAGG - Intergenic
1102152053 12:110695569-110695591 TATTGCAAAGGAATGAGCTGGGG + Intronic
1102599685 12:114020307-114020329 TTTACCAAAGGAATTAAGGGGGG - Intergenic
1102649912 12:114433224-114433246 TTTTACAAAGAAAGAAACTGAGG + Intergenic
1102655385 12:114478715-114478737 TTTTACAAATGAAGAAACTGAGG - Intergenic
1102806802 12:115788767-115788789 TTTTACAAAGGAGGCAACTGAGG + Intergenic
1103044397 12:117723445-117723467 TTTTACAGAGGAATAAACTGAGG + Intronic
1105323569 13:19349754-19349776 TTTTAGAGAGGAATGGACTGTGG + Intergenic
1105399389 13:20074832-20074854 TTTTAAAAAGGAAGGAAGGCCGG - Intronic
1105591393 13:21795831-21795853 TTTTACAAAGAAGTGGACTGAGG - Intergenic
1105870383 13:24499747-24499769 TTTTAGAGAGGAATGGACTGTGG - Intronic
1105893254 13:24697179-24697201 TTTTACAAAGGAGGAAACTGAGG - Intronic
1106320017 13:28628707-28628729 TTTTACAGAGGAAGAAACAGAGG + Intergenic
1107000636 13:35540405-35540427 TTTTACAAAGGGATGAGGTGGGG - Intronic
1107730756 13:43346093-43346115 ATTTACAAAGCACTCAACGGTGG - Intronic
1108093067 13:46870938-46870960 TTTAACAAAGGAAAAAACTGAGG + Intronic
1108375130 13:49807216-49807238 TTTTACAGAGGAATACACCGAGG + Intergenic
1109189910 13:59311764-59311786 TTTTACAAATGAAAGAACTGAGG + Intergenic
1109550677 13:63895127-63895149 TTTGAGAAAGGAAAGAACAGAGG + Intergenic
1110144724 13:72176887-72176909 TTTTAGAAATGAGTGAACTGAGG - Intergenic
1110600308 13:77365121-77365143 TTGTGCAAAGGAATAAAAGGGGG + Intergenic
1110719613 13:78746528-78746550 TTTTACAAAGAAATTAAGGCTGG - Intergenic
1110851728 13:80253700-80253722 TTTAAAAAATGAATGAAAGGAGG + Intergenic
1111280538 13:86017039-86017061 TTCCACAAAGGAATGACAGGAGG + Intergenic
1111785855 13:92785823-92785845 TCTTAGAAAGGAAAAAACGGAGG - Intronic
1112098377 13:96159969-96159991 TTTTACAAATGAGAGAACTGGGG - Intronic
1112590613 13:100760786-100760808 TTTTACAAATGAATGAACCAAGG + Intergenic
1113273277 13:108698902-108698924 TTTTACAAATGAGGGAACTGAGG + Intronic
1113341246 13:109428232-109428254 TTTTACAAATGAAACAACTGTGG - Intergenic
1113424321 13:110195438-110195460 TTTTACAAATGAAGAAACTGAGG + Intronic
1113821826 13:113220032-113220054 TTTTACACATGAAGAAACGGAGG - Intronic
1114036307 14:18632006-18632028 TTTTACAAATGAAGGACCTGGGG - Intergenic
1114122329 14:19683028-19683050 TTTTACAAATGAAGGACCTGGGG + Intergenic
1114414756 14:22534447-22534469 TTTTACAAAAGAAGAAACTGAGG + Intergenic
1115232278 14:31173995-31174017 TTTTACAAATGAGGGAACTGAGG - Intronic
1115397798 14:32928805-32928827 TTTTACAAATAAAGGAACTGAGG + Intergenic
1115443560 14:33463649-33463671 TTTTACAAATGGATAAACTGAGG + Intronic
1115462495 14:33676935-33676957 TTGTATAGAGGAATGAACAGAGG + Intronic
1116595118 14:46832087-46832109 TTTTACACATGAAGGAATGGAGG + Intergenic
1116672671 14:47863230-47863252 TTTTACAGATGAAGGAACTGAGG + Intergenic
1116787020 14:49298975-49298997 TTTTAAAAATTAATGAACTGGGG + Intergenic
1117205001 14:53432854-53432876 TTTTACAGAGAAAGGAACTGAGG - Intergenic
1117206827 14:53451910-53451932 ATTTACAAACAAATGAATGGGGG + Intergenic
1118049150 14:62007235-62007257 TATTGCAAAGGAAGGAAAGGTGG - Intronic
1118491203 14:66262683-66262705 TTTTACAAATGAAGAAACTGAGG + Intergenic
1118771827 14:68947445-68947467 TTTTACAGAGGAAGAAACTGAGG + Intronic
1118909585 14:70050119-70050141 TTTTACAAAGGAGGGGACTGAGG - Intronic
1119140030 14:72258673-72258695 TTTGACAAATGAATAAACAGAGG - Intronic
1119331736 14:73800049-73800071 TTTTACAGATGAATGAGCTGTGG + Intergenic
1119602704 14:75987551-75987573 TTTTACAAAGGAGGAAACTGAGG - Intronic
1119739782 14:77006873-77006895 TTTTACAGAGAAAGGAACTGAGG - Intergenic
1121265311 14:92598539-92598561 TTTTACAGATGAAGAAACGGAGG + Intronic
1121333975 14:93065520-93065542 TTTTACAGAAGAATAAACTGAGG + Intronic
1121481707 14:94282901-94282923 TTTTACAAAGGAAAGAAAGAGGG - Exonic
1121604708 14:95232026-95232048 TTTTACAGATGAAGAAACGGAGG + Intronic
1121814583 14:96919549-96919571 TTTTACAGAAGAAGGAACTGAGG + Intronic
1122158676 14:99767292-99767314 TTTTACAGAGAAAAGAACTGAGG - Intronic
1122527505 14:102398388-102398410 TTATAGAAAGAAATGAAAGGGGG + Intronic
1123963572 15:25433570-25433592 TTTGACAAAAGAAGGAACGAAGG + Intronic
1124103194 15:26714163-26714185 TTTTACAAGGGAAGAAACTGAGG - Intronic
1124846677 15:33298230-33298252 TTTTACAAATGAGTTAACTGAGG - Intergenic
1124985688 15:34610043-34610065 TTTTACAGAGGAGTGGAAGGTGG - Intergenic
1126383085 15:48067941-48067963 TTTTACAGAGGAGAAAACGGAGG + Intergenic
1126539936 15:49810688-49810710 TTTTACAGAGGAAAGCACTGAGG - Intergenic
1127232078 15:57007576-57007598 TTTTACAAAGGAAGAAACTTAGG - Intronic
1127316018 15:57794241-57794263 TTTTACAAATGAAGAAACTGAGG - Intergenic
1127599132 15:60517706-60517728 TTACACAAGGGTATGAACGGTGG - Intronic
1127932343 15:63605323-63605345 TTTTACAAATAAAGAAACGGAGG - Intergenic
1128440607 15:67704994-67705016 TTTTACAAATGAAGAAACTGAGG - Intronic
1128732078 15:70028070-70028092 TTTAACAAAGGAAGAAACTGAGG + Intergenic
1128753807 15:70167323-70167345 TTTTACAAATGAAGGAAATGAGG + Intergenic
1128775622 15:70317901-70317923 TTTTATAGAGGAGTAAACGGAGG - Intergenic
1129228336 15:74182630-74182652 TTTTACAGAGGAAGAAACTGAGG - Intronic
1129519366 15:76176299-76176321 TCTTACAGAGGAAGGAACTGAGG - Intronic
1129864694 15:78896765-78896787 ATATACAAAGGAATGAACTCTGG - Intronic
1130675799 15:85950930-85950952 TTTTACAGAGGAAGAAACAGAGG + Intergenic
1130812360 15:87393300-87393322 CTTTAAAAAGGAATAAACTGTGG - Intergenic
1131069989 15:89460119-89460141 TTGAAGGAAGGAATGAACGGGGG + Intergenic
1131124656 15:89848877-89848899 TTTTAGAAAGAAATGAAAAGAGG + Intronic
1131487762 15:92836328-92836350 TTTTACAAATGAATGAACCAAGG + Intergenic
1131553657 15:93378580-93378602 TTTTACGAAGGAGAGAACCGTGG + Intergenic
1131844280 15:96472122-96472144 TTTTATAAACGAATGAATGAAGG + Intergenic
1132068661 15:98754798-98754820 TTTTACAGATGAAGGAACAGAGG + Intronic
1132302983 15:100787921-100787943 CTTTACACAGGAATCAACTGAGG - Intergenic
1133330737 16:4971818-4971840 TTTCTCAAAGGAATGAAAGGAGG - Intronic
1133335998 16:5007140-5007162 TTTCACAGAGGAAGGAATGGAGG - Intronic
1133772584 16:8875973-8875995 TTTTACAGATGAAGAAACGGAGG - Intergenic
1133789522 16:8998806-8998828 TTTAAAAAAGGAATGAATGCAGG - Intergenic
1134112199 16:11522643-11522665 TTTTACAGAGGAAGAAACTGAGG + Intronic
1134231037 16:12430536-12430558 TTTTACAAATGAATAAACTGAGG - Intronic
1134260205 16:12644999-12645021 TTTTACAGATGAAGGAACTGAGG + Intergenic
1134838009 16:17377938-17377960 TTGTACAAAGGGAAGAACTGAGG + Intronic
1135139457 16:19909112-19909134 TTTTACAGAGGAAGAAACTGAGG - Intergenic
1135162812 16:20112489-20112511 TTTTACCACGGAGGGAACGGAGG - Intergenic
1136086087 16:27886125-27886147 TTTTACAGATGAAGGAACTGAGG - Intronic
1136558886 16:31026576-31026598 TTTTATAAAGGAAGGAGTGGAGG - Intergenic
1137936584 16:52640605-52640627 CTCTACAAAAGAAGGAACGGAGG - Intergenic
1138128896 16:54461903-54461925 TTTTACAAATGAATAAACTGAGG - Intergenic
1138139184 16:54552636-54552658 TTTTACAAAGGAGGAAACTGAGG - Intergenic
1138308952 16:56006846-56006868 TTTTACAAAGGAGAAAATGGAGG + Intergenic
1138386821 16:56641147-56641169 TTCTACAAAGGAAGAAATGGAGG - Intronic
1138612682 16:58139679-58139701 ATTTAAAAAGGAAGGAAGGGAGG - Intergenic
1138627423 16:58263656-58263678 TTTTACAAATGAAAAAACCGGGG + Intronic
1138787518 16:59864759-59864781 TTTTACACAGGAAGGTAGGGAGG + Intergenic
1139319357 16:66101014-66101036 TTTTACAAATGAAGAAATGGAGG + Intergenic
1139399279 16:66667391-66667413 TTTTATAAAGCAATGAACTAGGG + Intronic
1139441790 16:66971750-66971772 TTTTACAAAGGAGGAAACTGAGG - Intronic
1140311184 16:73850041-73850063 TTTTTAAAAGGAAGGAAGGGAGG + Intergenic
1140884456 16:79230527-79230549 TAGTACAAAGGAATAAACGTGGG + Intergenic
1140918469 16:79515044-79515066 ATTTACAAAGGTGTGAGCGGAGG - Intergenic
1141181567 16:81756435-81756457 TTTTACAGATGAGGGAACGGAGG + Intronic
1141182197 16:81761583-81761605 TTTTACAAAGGAGGAAACTGGGG - Intronic
1141789146 16:86221721-86221743 TTTTACAAAGGAGTAAAGTGAGG - Intergenic
1141862078 16:86724403-86724425 CTTTAACAAGGAATGAAGGGTGG + Intergenic
1141976413 16:87519195-87519217 TTTTACAAAGGAGGAAACTGAGG - Intergenic
1142497245 17:312742-312764 TTTTACAGATGAAAGAACAGAGG + Intronic
1142822886 17:2485970-2485992 ATTCACAAAGGAAGGAACGAAGG + Intronic
1143157690 17:4848805-4848827 TTTTACAAAGGACAAAACTGAGG - Intronic
1143211705 17:5192671-5192693 CTTTACAAATGAAGCAACGGAGG - Intergenic
1143260309 17:5593688-5593710 TTGAACAAAGGAATGAATGAAGG + Intronic
1143295191 17:5866014-5866036 TTTTACAGAGGAGGAAACGGAGG + Intronic
1143774518 17:9189215-9189237 TTTTACAGAGGAGTAAACTGAGG + Intronic
1144845798 17:18218283-18218305 TTTTACAAAGGAAGAAACTGAGG - Intergenic
1145015642 17:19395936-19395958 TTTTACAAAAGAATTAACACAGG - Intergenic
1145264865 17:21374915-21374937 TTTTACAGATGAAGGAACTGAGG - Intergenic
1145966908 17:28925725-28925747 TTTTAGAAAGGAAGAAACGGAGG - Intronic
1146475235 17:33157362-33157384 TTTTACAGATGAATAAACCGAGG + Intronic
1146541752 17:33702178-33702200 TTTTACAGATGAAGGAACTGAGG - Intronic
1147542029 17:41368395-41368417 TTTTGCAAAGGCATGAACAAGGG - Intronic
1147582469 17:41635120-41635142 TTTTACAAACGAGGGAACGGAGG - Intergenic
1148823326 17:50373615-50373637 TTTTACTAAGGAAGAAACTGAGG + Intronic
1149028564 17:52058400-52058422 TTTTACAAATGAGTAAACTGAGG + Intronic
1149337643 17:55653143-55653165 TTTTACAGAGGAAGAAACTGAGG - Intergenic
1149543188 17:57484014-57484036 TTTTACAAATGGAGAAACGGAGG + Intronic
1149753564 17:59168875-59168897 TTTTACAGAAGAATAAACTGAGG - Intronic
1152313673 17:79566937-79566959 TTTTACAAAGAAGAGAACAGAGG - Intergenic
1152466697 17:80470708-80470730 TTTTCCCCAGGAATGAACCGAGG - Exonic
1153710381 18:7793288-7793310 TTTTACAGACGAATAAACCGAGG - Intronic
1154007962 18:10549527-10549549 TTTTACAAATGAATTAACTGAGG - Intronic
1154203569 18:12318144-12318166 TTTTACAAAGGAAAGACCCAGGG - Intronic
1154390909 18:13935213-13935235 TTTTACAGATGAAGGAATGGAGG - Intergenic
1155318728 18:24597354-24597376 TTTTACAGAGGAAGAAACTGAGG + Intergenic
1155752061 18:29437472-29437494 TTTTACAAATGAAAAAACAGAGG - Intergenic
1155832253 18:30532550-30532572 TTTTACAAAAGACTGACCGCAGG + Intergenic
1156852431 18:41744012-41744034 TTTTGCAAAGTAATAAAGGGAGG + Intergenic
1156930874 18:42641682-42641704 TTTTACAAATGAAGAAACTGAGG - Intergenic
1157404626 18:47412602-47412624 TTTAATAAAGGAAGGAAGGGAGG - Intergenic
1157600587 18:48890744-48890766 TTTTACAAATGAAAGAATTGAGG + Intergenic
1157910620 18:51614544-51614566 TCTTACAGAGGAAAGAACTGAGG - Intergenic
1157976152 18:52329186-52329208 GTTTACAAAGGAAGAAATGGAGG + Intergenic
1158411891 18:57213300-57213322 TTTTACAAATGATGGAACTGAGG - Intergenic
1159156914 18:64595915-64595937 TTTTAAAAAGAAATGAACAGTGG - Intergenic
1160971186 19:1768479-1768501 CTTTACAAAGGAAGGGACTGAGG + Intronic
1162524277 19:11198087-11198109 TTTTACAGATGAATAAACTGAGG - Intergenic
1162530218 19:11231636-11231658 TTTTACAAATGAAGAAACTGAGG + Intronic
1162804691 19:13131243-13131265 TTTTACAGATGAATAAACTGAGG + Intronic
1162820358 19:13219537-13219559 TTGTACAAACGAAGGAACTGTGG + Intronic
1163494842 19:17640353-17640375 TTCTACAGAGGAATAAATGGAGG + Intronic
1164189706 19:22902635-22902657 TTTTAAAATGGAGTGAACGAAGG - Intergenic
1164474491 19:28564706-28564728 TTTTACAGATGAACTAACGGAGG - Intergenic
1165341509 19:35215476-35215498 TTTTACAGATGAAGGAACTGAGG - Intergenic
1167781143 19:51599956-51599978 TTTTACAAAAGATGAAACGGAGG - Intergenic
925821846 2:7806515-7806537 TATGACAATGGAATGAATGGAGG + Intergenic
927045239 2:19271619-19271641 TTTTACAGATGAATAAACTGAGG + Intergenic
927326190 2:21807985-21808007 TTTTAAAAAGTAATGGAAGGGGG + Intergenic
927489116 2:23508966-23508988 TTTTACAGATGAGGGAACGGAGG - Intronic
928040264 2:27868668-27868690 TGTTACACAGGAAAGAATGGTGG + Intronic
928425184 2:31171871-31171893 TTTTACAAATGAATAAACTGAGG + Intergenic
928737395 2:34308091-34308113 TTTTCCAAAGGCATTAACTGTGG - Intergenic
930396990 2:50834660-50834682 TTTTACAAATGAGTAAACTGAGG - Intronic
930565971 2:53021004-53021026 TTTTACAAATGAGGGAACTGAGG - Intergenic
930749053 2:54915003-54915025 TTTTGCAAAGGAAGCAACTGAGG - Intronic
930883660 2:56299834-56299856 TTGTAAAAAGAAATGAATGGAGG - Intronic
931000580 2:57776469-57776491 TTTTACAGAGGAAGAAACTGTGG + Intergenic
931632942 2:64317459-64317481 TCTTAAAAAGGCATGAAAGGTGG - Intergenic
931685890 2:64792628-64792650 TTTTACAGATGAAGGAACTGAGG - Intergenic
932043348 2:68322299-68322321 TTTTACAAATGAAGAAACTGGGG - Intergenic
932156861 2:69425847-69425869 TTTTACAAATGAAGACACGGAGG + Intronic
932375743 2:71234340-71234362 TTTTACAAATGGATAAACTGAGG + Intergenic
932816832 2:74868449-74868471 TTTTACAGATGAATAAACTGAGG - Intronic
933697667 2:85231909-85231931 TTTTACAGATGAAGAAACGGAGG - Intronic
933921210 2:87048663-87048685 TTTTACAAATGAAGAAACTGAGG + Intergenic
934001756 2:87720922-87720944 TTTTACAAATGAAGAAACTGAGG - Intergenic
935360374 2:102241442-102241464 TTTTACAGAGGAAGAAACTGGGG - Intergenic
935419199 2:102849178-102849200 TTCTACAAATGAATAAACTGAGG - Intergenic
935812715 2:106815690-106815712 TTTTACAGATGAAGGAACTGGGG + Intronic
936258720 2:110938504-110938526 TTTTACAAATGAGTAAACTGAGG + Intronic
936362706 2:111820314-111820336 TTTTACAAATGAAGCAACTGAGG + Intronic
936748604 2:115612701-115612723 TTTCACAGAGGAAGGAACTGAGG - Intronic
937047232 2:118858350-118858372 TTTTACAAAGGAGGAAACTGAGG + Intergenic
937253792 2:120540839-120540861 TTTTACAGAGGAGGAAACGGAGG + Intergenic
937375607 2:121333828-121333850 TTTTACAGAGGAAGAAACTGAGG + Intergenic
937493647 2:122395461-122395483 TTTTACAAATGAAGGAACTGAGG + Intergenic
938017925 2:127883516-127883538 TTTTACAAATGAAAGAACTGAGG - Intronic
938441285 2:131336112-131336134 TTTTACAAATGAAGGACCTGGGG - Intronic
938730377 2:134142534-134142556 TTTTACAGATGAGTGAACTGAGG + Intronic
938847510 2:135225188-135225210 TTTTACATAGGAAGAAACTGAGG + Intronic
939281443 2:140070579-140070601 TTTTACAAATGAGTCAACTGAGG - Intergenic
939340523 2:140889673-140889695 TTTTACACAGGAAGAAACAGAGG + Intronic
939917911 2:148070624-148070646 TTTAACAAAGCAATGAACCAAGG - Intronic
940590195 2:155714121-155714143 TTTTACAAATGAAGGAACTGAGG + Intergenic
941316301 2:163997140-163997162 ATTTATAAAGGAATGAAGTGTGG - Intergenic
941370088 2:164654391-164654413 TTTTACAAAGGGGTAAACAGCGG + Intronic
941445740 2:165596962-165596984 ATTTACAAAGGAAACAACTGAGG + Intronic
941770634 2:169341735-169341757 TTTTACTAATGAGTGAACTGAGG - Intronic
942500705 2:176587721-176587743 TTATACAAATGAATAAACTGAGG + Intergenic
942747247 2:179248519-179248541 TTATACAAAGTAATCAAGGGGGG + Intronic
943677612 2:190731481-190731503 TTTTACAAATCAGTGAAAGGAGG - Intergenic
943944029 2:194035661-194035683 TTTTACAAATGAGGGAACTGAGG + Intergenic
944049057 2:195445899-195445921 TTTTAAAAAGGAATGAAGGCTGG - Intergenic
944825713 2:203481324-203481346 TTTTACAATGGAAGGAACGGAGG - Intronic
945329839 2:208526105-208526127 TTTTAAAAAGAAATGAAAGTTGG - Intronic
947060356 2:226157553-226157575 TATTGCAAGGGAATGAACTGAGG - Intergenic
947155076 2:227154194-227154216 TTTCATAAAGGAGTGAAGGGGGG - Intronic
1169398131 20:5254077-5254099 TTTTCCCAAGGAATGATAGGAGG + Intergenic
1169837640 20:9898348-9898370 TTTTACAAAAGAAGAAACCGAGG + Intergenic
1170099620 20:12684478-12684500 TTTTACAAATGAATGAATGGAGG - Intergenic
1170370759 20:15645443-15645465 TGTTCCAAAGAAATGAATGGAGG + Intronic
1170612499 20:17926120-17926142 TTTTACAGATGAATAAACTGAGG - Intergenic
1171041894 20:21771885-21771907 TTTTACAGATGAAGGAACTGAGG - Intergenic
1172180108 20:32997833-32997855 TTTTACAGAGGAGGGAACAGAGG - Intronic
1173105743 20:40132380-40132402 TTTCACAAATGACTGAAAGGAGG - Intergenic
1173215943 20:41083632-41083654 TTTTATATAGCAATGAAAGGTGG - Intronic
1173317225 20:41955827-41955849 TTTTACAGATGAAGGAACTGAGG - Intergenic
1173554348 20:43954884-43954906 TTTTACATAGGAAGAAACTGAGG - Intronic
1173639933 20:44594536-44594558 TTTTACAAAAGAAGAAACTGAGG + Intronic
1173833116 20:46105448-46105470 TTCTACAAAGGAAAAAACTGAGG - Intergenic
1174106435 20:48165650-48165672 TTTTACAGATGAAGAAACGGAGG + Intergenic
1174506126 20:51018720-51018742 TTTTACAAATGAAGAAACTGAGG + Intronic
1174593863 20:51668063-51668085 TGTTACAAAAGAAGGAAGGGAGG + Intronic
1175016900 20:55801432-55801454 TTTTACACAGGAAGAAACTGAGG - Intergenic
1175130576 20:56786438-56786460 TTTTACAAATGAAGAAACTGAGG - Intergenic
1177833414 21:26165393-26165415 TTTTACAAAGGAAAAAACTGAGG + Intronic
1178186152 21:30223502-30223524 TTTTTCAATGGAGTGAAGGGTGG - Intergenic
1178590489 21:33905368-33905390 TTTTACATATGAGGGAACGGAGG + Intronic
1178734713 21:35138494-35138516 TTTCACAGAGGAAGGAACTGAGG - Intronic
1179064319 21:38010134-38010156 TTTTACAAATGAAGAAACTGAGG - Intronic
1180460434 22:15559066-15559088 TTTTACAAATGAAGGACCTGGGG - Intergenic
1181654265 22:24282665-24282687 TTTTAATAAGGAATGAATGTTGG + Intronic
1181673691 22:24438243-24438265 TTTTACAAATGAAGAAACTGAGG + Intronic
1181708691 22:24666414-24666436 TTTTAATAAGGAATGAATGTTGG + Intergenic
1181746377 22:24957561-24957583 TTTTACAGAGGAAGAAACTGAGG - Intronic
1181773488 22:25143518-25143540 TTATAGAAAGGAAGGAAGGGAGG - Intronic
1181889903 22:26053371-26053393 TTTTACAGAGGAAAAAACAGAGG + Intergenic
1182040720 22:27237106-27237128 TTTTACAGATGAATAAACTGAGG + Intergenic
1182075659 22:27493757-27493779 TTTTACAGAGGAGGGAACTGAGG + Intergenic
1182171789 22:28237708-28237730 CTATACAAAGGAAAGAAGGGAGG - Intronic
1182302825 22:29347409-29347431 TTTTACAAATGAAGAAACTGAGG + Intronic
1182327991 22:29528896-29528918 TTTCACAAAGGAATAAACTGAGG + Intronic
1182923377 22:34100642-34100664 TTTTACAAAGGAAGAAAATGAGG + Intergenic
1183256228 22:36764185-36764207 TTCCCCAAAGGAATGAACGGAGG + Intronic
1184272091 22:43390252-43390274 TTTTACAGAGGAAGAAACTGAGG - Intergenic
1184551189 22:45205003-45205025 TTTTACAGAGGAGGAAACGGAGG + Intronic
1184647962 22:45906404-45906426 TTTTACTGAGGAAGAAACGGAGG + Intergenic
950078147 3:10201946-10201968 TTTTACAAATGAGTAAACTGAGG - Intronic
950119610 3:10472934-10472956 TTTTACAAAGGAGGAAACTGAGG + Intronic
950567970 3:13782492-13782514 TTTGTCAAAGGAATGAACTGGGG - Intergenic
950910321 3:16582760-16582782 TTTTACAAAGGAGGAAACTGAGG + Intergenic
951112179 3:18817132-18817154 TTTTACATAAGAGTGAAGGGTGG - Intergenic
951488132 3:23237096-23237118 TTTTACAGATGAAGGAACTGAGG - Intronic
951980152 3:28556818-28556840 TTTTACAAAGGAGAAAACTGAGG - Intergenic
952860295 3:37807207-37807229 TTTTACAGAGGAAGAAACTGAGG - Intronic
953129737 3:40126439-40126461 TTTCAAAAAGGAATGAATGAGGG + Intronic
953499061 3:43415284-43415306 TTTTACAGAGGAAGAAACTGAGG + Intronic
953505207 3:43479535-43479557 TTTTTGAAAGGAAGGAAAGGAGG + Intronic
953587003 3:44210852-44210874 CTTTACAAATGGATGAACTGAGG - Intergenic
953939049 3:47074684-47074706 GTTGAGAAAGGAATGAACTGTGG - Intronic
954447359 3:50553868-50553890 TTTTACAAATGAGTCAATGGAGG + Intergenic
955448871 3:59045851-59045873 TTTTACAAATGAACAAACTGAGG - Intronic
955645752 3:61135464-61135486 TTTTATAAAGGAAGGAACTGAGG + Intronic
955969164 3:64419805-64419827 TTCTAAAAAGGATTGAAGGGAGG + Intronic
955981752 3:64534272-64534294 TTTTACAGATGAATAAACTGAGG - Intronic
956151447 3:66247311-66247333 ATTTACAAATGAATGAATGATGG + Intronic
956407357 3:68941803-68941825 TTTTACCAATGAATAAACTGAGG + Intergenic
956446847 3:69334219-69334241 TTTTACAAATGAAGAAACTGGGG - Intronic
956542191 3:70352764-70352786 TTTTCCAAAGGAAAAAAAGGAGG + Intergenic
956749738 3:72336289-72336311 TTTTACAGAGGAATAAACTGAGG - Intergenic
956807083 3:72825999-72826021 TTTTACAAAGGTAGAAACTGAGG + Intronic
956866552 3:73374612-73374634 CTTAATAAAGGAATGAACTGGGG - Intergenic
956873617 3:73441593-73441615 TTTTACCCAGGAAGGAACTGGGG + Intronic
956924535 3:73969703-73969725 TTTTACAAATGAAGAAACTGAGG + Intergenic
957384210 3:79474424-79474446 TTTTAAAAAGGAAGGAACTGAGG - Intronic
957521558 3:81325029-81325051 TTTTACCAAGCAATGAACATGGG + Intergenic
957761344 3:84561539-84561561 TTTTACAAAGGATTGAACTGAGG - Intergenic
957945825 3:87061471-87061493 TTTTACAGAGGAAGAAACTGAGG + Intergenic
959111922 3:102132845-102132867 TTTTACAAAGGCATGAGTGATGG + Intronic
959551937 3:107669815-107669837 TTTTACAGATTAATGAACAGAGG + Intronic
960022706 3:112973505-112973527 TTTTACAAAGGTAGAAATGGAGG - Intronic
960041331 3:113152450-113152472 TTTTACAAATGAAGAAACTGAGG + Intergenic
960587631 3:119334816-119334838 TTTTACAAAGGAAGAAACTGAGG + Intronic
960666407 3:120113145-120113167 TTGTACAAATGAAGGAACTGAGG + Intergenic
960686432 3:120299106-120299128 TTTTCCAAAGGAGTGAACTTGGG - Intergenic
960883584 3:122371385-122371407 ATGTACAAAGGAATGAAAGGAGG - Intronic
961028662 3:123584109-123584131 TTTTACAAATGAAAAAACGGAGG + Intronic
961199201 3:125030733-125030755 TTTTACATAGGAAGCAAAGGAGG + Intronic
961244727 3:125441227-125441249 TTTTAAAAAGGAAGAAACTGAGG - Intergenic
961496128 3:127293121-127293143 TTTTACAAAGGAAGAAACAGGGG + Intergenic
961545964 3:127633427-127633449 TTTTACAAATGAAATAACTGAGG - Intronic
961545977 3:127633564-127633586 TTTTACAAATGAAATAACTGAGG - Intronic
961579968 3:127872899-127872921 CTTGACAAATGAATGAATGGAGG - Intergenic
961860285 3:129911721-129911743 ATTTACAAATGAGTGAATGGTGG + Intergenic
962374302 3:134847391-134847413 TTTTACAGAGGAGTAAACTGAGG - Intronic
963734236 3:149001950-149001972 TTTTACAAATGAAGGAATGGAGG + Intronic
966637207 3:182148713-182148735 TTTTACAGATGAAGGAACTGAGG + Intergenic
967103634 3:186237565-186237587 TTTTAGAAATGAAGGAACTGAGG - Intronic
967261928 3:187651000-187651022 TTTTACAAAGGAGGAAACTGAGG + Intergenic
967283108 3:187841615-187841637 CATTACAAAGGAATGAACTGAGG + Intergenic
967420870 3:189271073-189271095 TTTTAAAAAGGAAGAAACTGAGG + Intronic
967528290 3:190519416-190519438 TTTTACAAATGAAAGAACTGAGG + Intronic
967625382 3:191677419-191677441 TTTTATTCAGGAATGAATGGTGG + Intergenic
968402404 4:309410-309432 TTTTGCAAAGGAAAGAATGTGGG - Intergenic
969165636 4:5308448-5308470 TTTTACTAAGGAAGAAACTGAGG - Intronic
970211527 4:13715145-13715167 TCCTACACAGGAATGAACGTAGG + Intergenic
970498206 4:16649641-16649663 TTTTACAAATGAGGGAACTGAGG - Intronic
970884724 4:20975054-20975076 TTTTACAAATGAGAGAACTGAGG + Intronic
971253525 4:24993058-24993080 TTTTACAAATGAATCAACAGAGG - Intergenic
972032230 4:34476120-34476142 TTTTACCAAGAGATGAATGGTGG - Intergenic
972331954 4:38072062-38072084 TCTCACAAAGGAAGGAACAGGGG - Intronic
972358880 4:38308214-38308236 TTTTACAAAGGAGGAAACTGAGG + Intergenic
973168395 4:47107576-47107598 TTTTACAGATGAATAAACAGAGG - Intronic
974101862 4:57425669-57425691 TTTTACAGATGAGTAAACGGAGG - Intergenic
974477602 4:62404245-62404267 TTTTACAAAGGAAAAAACTTAGG + Intergenic
975049006 4:69836226-69836248 TTTTACATGGGACTGAATGGAGG - Intronic
975225994 4:71872540-71872562 TTTCCCAAAGGAATGAAGAGTGG - Intergenic
975257929 4:72260540-72260562 TTGTACAAATGAATAAACAGTGG + Intergenic
975464066 4:74689401-74689423 TTTTAAAAAGGAAGAAATGGAGG - Intergenic
975761116 4:77620833-77620855 TTTCACAAAGTAAAGAACGAAGG + Intergenic
976100939 4:81562554-81562576 TTTTACAAATGAAGAAACTGAGG + Intronic
976329734 4:83815646-83815668 TTTTACAGAGGAAGAAACTGAGG - Intergenic
976439906 4:85061238-85061260 TTGTCCAAAGGAATGAATAGTGG + Intergenic
976537473 4:86235181-86235203 TTTTCCAAATGAAGGAATGGAGG + Intronic
976749756 4:88442373-88442395 TTCTACAATGGAAAGAATGGAGG + Exonic
977189294 4:93979303-93979325 TTTTACAAATGACTAAACTGAGG + Intergenic
977297868 4:95230854-95230876 TTTTACAAAGGAAGAAACTGAGG - Intronic
977888738 4:102282053-102282075 TTTTACAAATGAGGGAACTGAGG + Intronic
978879470 4:113683982-113684004 TTTTACAAAAGAAGAAACTGAGG - Intronic
979670712 4:123357500-123357522 TTTTAAAAAGCAAGGACCGGCGG - Intergenic
979755638 4:124337342-124337364 TTTTACAAAGGAGGAAACTGAGG - Intergenic
980039135 4:127918723-127918745 TTTTACAGATGAAAGAATGGAGG - Exonic
980653858 4:135757154-135757176 TTTTACATAAGATTGAACAGTGG - Intergenic
980856745 4:138450038-138450060 ATTTACCAAGCAATGAATGGAGG + Intergenic
981220402 4:142225692-142225714 TTGTATATAGGAATGAAAGGGGG + Intronic
981277523 4:142919057-142919079 TTTTACAGGGGAATGAAGTGAGG - Intergenic
981418648 4:144523391-144523413 TTTTACATAGGAGGGAACTGAGG + Intergenic
982012618 4:151121113-151121135 TATTACAAAGAAATGAGCTGTGG + Exonic
982176586 4:152711053-152711075 TTTTACAAAAGAGGAAACGGAGG + Intronic
982538744 4:156640630-156640652 TTTTACAAGGGAGTAAACTGAGG + Intronic
982548435 4:156764424-156764446 TTTTACACATGAGTGAACAGAGG + Intronic
982642187 4:157976228-157976250 TTTTACAAATGAGGGAATGGAGG - Intergenic
983076851 4:163337085-163337107 TTAAACAAAGGAATGAAAGGAGG - Intronic
984101479 4:175491788-175491810 TTTTATAAAGGAAAGAACTGAGG + Intergenic
984607126 4:181798205-181798227 TTTTACAAACGAGGGAACTGAGG + Intergenic
985019410 4:185671464-185671486 TTTTACACATGAAGGAACTGAGG - Intronic
986298332 5:6457669-6457691 TTTTACAGAGGAAGAAACTGAGG + Intronic
988131855 5:27116618-27116640 TTTTACAAGGAAATGCACAGAGG + Intronic
988334746 5:29892477-29892499 TTTTATAAAGGAAGAAACTGAGG + Intergenic
989156500 5:38349490-38349512 TTTTACAGAGGAAGAAACTGAGG + Intronic
989191010 5:38669751-38669773 TTTTACAAATGAAGAAACAGAGG + Intergenic
989309297 5:39995742-39995764 TTTTACAAATGAGGGAACTGAGG + Intergenic
989814670 5:45721818-45721840 TGTTACAAGGGAATGAGAGGGGG + Intergenic
990014871 5:51047665-51047687 CTTTACAAAGAAATCAAGGGAGG - Intergenic
990539727 5:56760342-56760364 TTTTACAAATGAAGAAACTGGGG + Intergenic
990748727 5:58988051-58988073 TTTTAAAAAGGAAAGAACAGGGG + Intronic
990956050 5:61340464-61340486 TTTTAAGAAGAAATGAACTGTGG - Intronic
991067583 5:62440651-62440673 TTTTAAAAAGGAATGCAGGCTGG - Intronic
991281307 5:64917417-64917439 TTTTTCCAAGGAAGGAACAGAGG + Intronic
993548649 5:89245503-89245525 TTTTACAGATGAATAAATGGAGG + Intergenic
994003209 5:94805750-94805772 TTTTACAAAGGAGGAAACTGAGG + Intronic
994342357 5:98645793-98645815 TTTTTCAGAGAAATGAACTGTGG + Intergenic
995404750 5:111781964-111781986 TTTTACAAATGAAGAAACTGAGG - Intronic
995625607 5:114072778-114072800 TGTTACAAATGAATAAACTGAGG - Intergenic
996017736 5:118559377-118559399 TTTTACAGAGGAATAAACTAAGG + Intergenic
996445349 5:123542688-123542710 ATTTTCAAAGCAATGAAAGGGGG - Intronic
996480078 5:123965984-123966006 TTTTATAAATGAATGAATGAAGG - Intergenic
996873790 5:128219171-128219193 TTTTACCAATGAAGGAACGGAGG + Intergenic
997538362 5:134640458-134640480 TTTTTTAAATGAATGAACGAAGG + Intronic
997744595 5:136288114-136288136 TTTTACAAAGGAAGAAACTGAGG + Intronic
997942566 5:138171772-138171794 TTTTACAAATGAAAAAACAGAGG + Intronic
998933461 5:147207227-147207249 GTTTACATAGGTATGAACTGGGG - Intergenic
999101921 5:149032647-149032669 TTTTACAGACGAATAAACTGAGG + Intronic
999254333 5:150201619-150201641 TTTTACAGAGGAATAAACTGAGG + Intronic
999326282 5:150645768-150645790 TTTTACAGAAGAAGAAACGGAGG - Intronic
999438737 5:151584706-151584728 TTTTACAAATGAAAAAACTGAGG + Intergenic
999507917 5:152217683-152217705 TTTTACAGAGGGACGAACTGAGG - Intergenic
999808712 5:155108070-155108092 TTTTTCAAAGGATTGGAGGGTGG + Intergenic
1000253106 5:159513733-159513755 TTTGACCAAGGAAGGAAAGGGGG + Intergenic
1000532694 5:162443787-162443809 TTTTACAAATGAAAAAACTGAGG + Intergenic
1001163209 5:169339729-169339751 TTTTACAAATGAGTAAACTGAGG + Intergenic
1001706815 5:173747459-173747481 TTTTACAAATGAAAGAACTTTGG + Intergenic
1002969630 6:2000821-2000843 TCTTAGAAAGGAATGAAGGCTGG - Intronic
1003732425 6:8840508-8840530 TTTTACAAAGAGAGGAACTGAGG + Intergenic
1004332142 6:14731557-14731579 TTTTACAAATGAAGAGACGGAGG + Intergenic
1005660770 6:27997279-27997301 TTTATCATAGGAATGAAAGGTGG + Intergenic
1006576892 6:35053173-35053195 TTTTCCAAAGGAATGAAAAGAGG - Intronic
1006615321 6:35322158-35322180 TTTTACAAATGGATGAATTGAGG + Intergenic
1006925598 6:37652676-37652698 TTTTACAAAGAAGGGAACTGAGG + Intronic
1007063711 6:38968090-38968112 ATTTGCAAAGGAATGAAGTGTGG + Intronic
1007395195 6:41573748-41573770 TTTTGCAGAGGAAGAAACGGAGG + Intronic
1007760395 6:44129897-44129919 TTTTACAAATGAAGAAACTGAGG + Intronic
1007797387 6:44361044-44361066 TTTTACAAAGGAGGAAACTGAGG + Intronic
1008368646 6:50709964-50709986 TGTTAAAAAGGAAGGAAAGGAGG + Intergenic
1008622922 6:53289347-53289369 TTTTACAATGGAACGAACTGAGG - Intronic
1008678969 6:53852104-53852126 TTTTACAGATGAATAAACTGAGG - Intronic
1008711601 6:54234260-54234282 TTTTAAAAATGAGTAAACGGAGG - Intronic
1008891297 6:56494521-56494543 TTTTACAGAGGAAGGAATTGAGG - Intronic
1008906873 6:56687460-56687482 TTTTACAAAAGAAGAAACTGAGG - Intronic
1009273992 6:61651590-61651612 TTTTACAAATGAAAAAACAGAGG + Intergenic
1009677623 6:66846646-66846668 TTTTATAAAGGAGTAAACTGAGG + Intergenic
1010060579 6:71617896-71617918 TTTTACAAACGAATAAAATGAGG + Intergenic
1011134792 6:84088489-84088511 TTTTACAAACGTATGAACTCAGG - Intronic
1012290974 6:97455041-97455063 TTTTGAAAAGGAATCAACAGAGG - Intergenic
1012727885 6:102839523-102839545 TTTTACAAATGAAGTAACTGAGG - Intergenic
1013822436 6:114171617-114171639 TTTTACAGATGAATGAAGTGAGG + Intronic
1014993858 6:128116736-128116758 TTTTACAGATGAATGAATTGAGG - Intronic
1015114580 6:129633701-129633723 TTTTACAGATGAGTGAACTGAGG - Intronic
1015187310 6:130432854-130432876 TTTTACAAATGAAGGAACTGGGG + Intronic
1015570877 6:134620237-134620259 TTTTATAAATGAAGGAACCGAGG + Intergenic
1016420915 6:143882099-143882121 TTTTACAAATGAGAAAACGGAGG - Intronic
1017128982 6:151091854-151091876 TTTTACAAGGGAAGAAACTGAGG - Intronic
1017235530 6:152113842-152113864 TTTTACAGAGGAAGAAACTGAGG + Intronic
1017790773 6:157797031-157797053 TTTTACAAAGGAGGCAACTGAGG - Intronic
1018588706 6:165391928-165391950 TTTTACAGAGGAGAGAAAGGAGG + Intronic
1019965253 7:4493648-4493670 TAATAAAAAGGAATGAACTGAGG + Intergenic
1020154776 7:5713869-5713891 TTTTACAGAGGAAGAAACAGTGG + Intronic
1020643387 7:10784006-10784028 TTTAACAAAGAAAAGAACAGTGG - Intergenic
1021218505 7:17946418-17946440 TTTTACAAATGAGTAAACTGAGG + Intergenic
1021552651 7:21888112-21888134 TTTTATAAATGAATGAAGTGAGG - Intronic
1021908270 7:25358137-25358159 TTTTACAAATGAAGAAACTGAGG + Intergenic
1022411119 7:30139349-30139371 TTTTACAGAGGAAGAAACTGAGG + Intronic
1022711200 7:32852730-32852752 TTTTACAAATGAAGAAACTGAGG + Intergenic
1023550915 7:41369280-41369302 TTGTATAAAGGAAAGAAGGGAGG - Intergenic
1024602316 7:50994724-50994746 TTTAAAAAAGGAATGAATGAAGG + Intergenic
1025870943 7:65433760-65433782 TTTTACATATGAGTGAACTGAGG + Intergenic
1026122004 7:67545969-67545991 TTTTAAAAAGAAATGTACGTTGG - Intergenic
1026425133 7:70283833-70283855 TTTAAAAAAGGAAAGAAAGGAGG + Intronic
1027413761 7:77951056-77951078 TTTTTCAAAGAAAGGAACTGTGG + Intronic
1028343181 7:89747429-89747451 TTTTACAAATCAATGAGCAGGGG + Intergenic
1028349349 7:89825854-89825876 TTTTACAAATGAGGGAACTGAGG + Intergenic
1028591037 7:92495050-92495072 TTTCACAAAAGAAGGAAGGGTGG - Intronic
1028851302 7:95541208-95541230 TTTTACAAATGAAAAAACTGAGG - Intergenic
1030096305 7:105903250-105903272 TTTTACAAAGGAAGAAACTGAGG - Intronic
1030666355 7:112282866-112282888 TTTTACAGATGAAGGAACTGAGG - Intronic
1031003129 7:116440640-116440662 TTTTACAAATGAATATACTGAGG + Intronic
1032473454 7:132194979-132195001 TTTTACAAATGAAGAAACTGGGG + Intronic
1032615406 7:133463980-133464002 TTTTACAGATGAAGGAACTGAGG + Intronic
1032631229 7:133654343-133654365 TTTTACAGATGAAGGAACTGAGG - Intronic
1032782283 7:135173041-135173063 TTTTAAAAAGGAAAGAAAAGGGG + Intergenic
1034159835 7:148985205-148985227 TTTTACAAATGAAGAAACTGAGG - Intergenic
1034272552 7:149810356-149810378 TTTTACAAAGGAAGGAACTGAGG - Intergenic
1034997931 7:155590177-155590199 TTTTACACATGAAAGAACAGAGG + Intergenic
1035816811 8:2550158-2550180 TTTTACAGAGGAAGCAACTGAGG - Intergenic
1035858612 8:3004090-3004112 TTTTTTAAAGAAATGAACGTGGG + Intronic
1035969510 8:4231953-4231975 TTTTGCAAAAGAAAGAAAGGAGG - Intronic
1035973868 8:4284984-4285006 TTTTACAAATAAAGGAACCGAGG - Intronic
1037407585 8:18559930-18559952 TTTTACAAAGGAACTAACCGAGG + Intronic
1038115802 8:24553840-24553862 TTTTGCAAAGGAGGGAACTGAGG + Intergenic
1038350614 8:26773082-26773104 TTTTACAAATGAAGAAACTGTGG + Intronic
1038590520 8:28833083-28833105 GTGTACAAAGGAATGCACGGAGG + Intronic
1038856510 8:31338905-31338927 TTTGAGAAAGGAGTGAATGGAGG + Intergenic
1038941018 8:32305958-32305980 TTTTACAATGGAAAGAAAAGAGG - Intronic
1039178391 8:34835153-34835175 TTTTACAAATGATGGAACAGAGG + Intergenic
1039939138 8:42074228-42074250 TTTGAAAAAGGAAGGAAAGGGGG - Intergenic
1040681950 8:49821076-49821098 TTTTAGAAATGAAGGAACTGAGG - Intergenic
1041145121 8:54867504-54867526 TTTTACATAAGAATAAACTGAGG - Intergenic
1041232408 8:55767031-55767053 TTTTACAAATGAAGAAACTGAGG - Intronic
1041232411 8:55767133-55767155 TTTTACAAATGAAGAAACTGAGG - Intronic
1041566258 8:59281919-59281941 TTTAAAAAAGGAAGGAAAGGAGG - Intergenic
1042049679 8:64690095-64690117 ATTTAAAAAGTAATGATCGGGGG + Intronic
1042551237 8:69995648-69995670 TTTTACAAATGAAGGAACCAAGG - Intergenic
1042754362 8:72193784-72193806 GTTTACATAGGATTGAACGGAGG + Intergenic
1042766464 8:72327335-72327357 GTTTACATAGGATTGAATGGAGG + Intergenic
1043240908 8:77934746-77934768 TTTTACAAATAAGTGAAGGGAGG + Intergenic
1043555539 8:81426760-81426782 GTTTACAGAGGAAGGAACTGGGG + Intergenic
1043955153 8:86351081-86351103 TTTTACAAAAGAAGAAACTGAGG - Intronic
1044420884 8:91994609-91994631 TTTTACAGATGAATAAACTGAGG - Intronic
1044676084 8:94730224-94730246 TTTTACAAATGAAGGGACTGGGG + Intronic
1044709746 8:95045124-95045146 TTTTACAAATGAAGAAACTGAGG - Intronic
1044910351 8:97051716-97051738 TTTTACAAATGAGTAAACTGAGG + Intronic
1045003227 8:97896250-97896272 TTTTAGAGATGAATGAACTGAGG - Intronic
1045480697 8:102589709-102589731 TTTTTCAAAAGAAGGAACTGAGG + Intergenic
1046271783 8:111905302-111905324 TTTTACACAGGAATGAGTGCTGG + Intergenic
1046289865 8:112144274-112144296 TTTTTCAAAGGAAAAAACTGAGG + Intergenic
1046693665 8:117314424-117314446 TTTTACAAATGAACAAACTGAGG + Intergenic
1046719811 8:117606634-117606656 TTTTACAAAGGAAAAAGAGGAGG - Intergenic
1047144560 8:122183277-122183299 TGTTACAAAGGAATGATCACAGG + Intergenic
1047337249 8:123948197-123948219 TTTTACAAATGAAGAAACTGAGG + Intronic
1048186366 8:132245162-132245184 TTTTGCAAATGAAAGAACTGAGG - Intronic
1048215647 8:132492134-132492156 TTTTACATAGGATAGAACGAAGG - Intergenic
1048257029 8:132912896-132912918 TTTTACAGAGGGAGGAACTGAGG - Intronic
1048511934 8:135070789-135070811 TTTTACAAATGAAAAAACTGAGG - Intergenic
1050161620 9:2725674-2725696 TTTTCCAAAGGAATTAGAGGTGG - Intronic
1050679757 9:8096969-8096991 TTTTACAGATGAATAAACTGAGG - Intergenic
1051550827 9:18327320-18327342 TATTCCAAAGGAATGAACTGAGG + Intergenic
1051916595 9:22216495-22216517 TTTAATAAAAGAATGAAAGGGGG + Intergenic
1052229892 9:26137195-26137217 TTTTACAAATGAATAAGTGGAGG + Intergenic
1053206837 9:36193438-36193460 TTTTACAAAGGAGAAAACTGAGG - Intronic
1053405369 9:37870604-37870626 TTTTACAGAGGAAGAAACTGAGG + Intronic
1053655204 9:40211973-40211995 TTTTACAAATGAATTAAAGGTGG + Intergenic
1053905588 9:42841209-42841231 TTTTACAAATGAATTAAAGATGG + Intergenic
1054367320 9:64358189-64358211 TTTTACAAATGAATTAAAGGTGG + Intergenic
1054529395 9:66164341-66164363 TTTTACAAATGAATTAAAGGTGG - Intergenic
1054674950 9:67847926-67847948 TTTTACAAATGAATTAAAGGTGG + Intergenic
1055087052 9:72324981-72325003 TTTTACAGATGAAGGAACGAGGG + Intergenic
1055124668 9:72705387-72705409 TTTTATAAATGAATAAATGGAGG - Intronic
1055398181 9:75895243-75895265 TTTTACAGATGAAGGAACAGAGG - Intronic
1055696914 9:78895086-78895108 TTTTACAGATGAACGAACTGAGG - Intergenic
1056200814 9:84274724-84274746 TTTTACAAAGGTAGGAGCGTAGG - Intergenic
1056282402 9:85054380-85054402 TTTTACAAAGGAGGAAACTGAGG - Intergenic
1056431469 9:86532541-86532563 TTTTACAGATGAATTAACTGAGG - Intergenic
1056502707 9:87225533-87225555 CTTTACAAAGGAAGTAACTGAGG - Intergenic
1057372153 9:94483784-94483806 TTTTACAAATGAATTAAAGATGG + Intergenic
1057448441 9:95135949-95135971 TTTTACAGATGAATAAACTGAGG - Intronic
1057768307 9:97943082-97943104 TTTTACAAGGGAAGAAACTGAGG - Intronic
1058560562 9:106224808-106224830 GTTTACAAAGGAAGGAACTGAGG + Intergenic
1058703215 9:107618098-107618120 TTTTACAAATGAAAAAACTGAGG - Intergenic
1058742073 9:107953829-107953851 TTTCACAAATGAAGGAACCGAGG - Intergenic
1058870594 9:109198415-109198437 TTTTACAGAGGAAGGAAGAGAGG + Intronic
1058959128 9:109976328-109976350 TTTTACAAAGGAGGAAACTGAGG + Intronic
1059206578 9:112472780-112472802 TTTTAAAAAGGGATGAATAGTGG - Intronic
1059343460 9:113612731-113612753 TTTTACAGAGGAAGAAACTGAGG + Intergenic
1059385120 9:113958585-113958607 TTTTACAGATAAAGGAACGGAGG + Intronic
1059459912 9:114423161-114423183 TTTTACAGAGGAAGAAACTGAGG + Intronic
1059646852 9:116276486-116276508 TTTCACAAAGGAAGAAACTGAGG - Intronic
1059688491 9:116660968-116660990 TTTTACAAATGAGAGAACTGAGG + Intronic
1059813845 9:117888840-117888862 TTTTACAAAGGAGGAAACTGAGG - Intergenic
1061049965 9:128189456-128189478 TTTTACAAATGAAGAAACTGAGG - Intronic
1061346045 9:130026056-130026078 TTTTACAGATGAAGGAACTGAGG + Intronic
1185975024 X:4710684-4710706 TGTTTCAAAGGATTCAACGGAGG - Intergenic
1186972141 X:14858716-14858738 TTTTACAAATGAAAAAACTGAGG + Intronic
1187329753 X:18326791-18326813 TTTTATAAATGAAGGAACTGAGG - Intronic
1188002527 X:24995636-24995658 TTTCACAGAGGAATGGTCGGCGG + Intronic
1188505684 X:30881732-30881754 TTTTACAAATGAAGAAACCGAGG + Intronic
1188537248 X:31211157-31211179 TTTTAAAAAGCAATGCAAGGAGG + Intronic
1188707275 X:33350603-33350625 TTTTACAGAAGAATAAACTGAGG - Intergenic
1188812257 X:34665189-34665211 TTTTATAAAGGAGGGAACTGAGG - Intergenic
1189300980 X:39952091-39952113 TTTTACAGAGGAAGAAACTGAGG + Intergenic
1189307740 X:39999839-39999861 TTTTACAAATGAAGAAACAGAGG + Intergenic
1189884252 X:45524066-45524088 ATTTATATAGTAATGAACGGAGG + Intergenic
1190324051 X:49195857-49195879 TTTTACAGATGAATAAACAGAGG + Intronic
1191724942 X:64269421-64269443 TTTTACAAATGAAGAAACTGAGG + Intronic
1191885077 X:65879933-65879955 TTTTCCTAAGGAATAAACTGAGG - Intergenic
1191927365 X:66328082-66328104 TTTTACAAATTAGGGAACGGAGG - Intergenic
1192048566 X:67702119-67702141 TTTTACAAATGAATAAACTGAGG - Intronic
1192863211 X:75101232-75101254 ATTTGCAAAGCAAGGAACGGGGG + Intronic
1192930622 X:75801905-75801927 TTTTTCACAGGAATGCACTGGGG + Intergenic
1193686537 X:84583160-84583182 TTTTACAGAGGAGAGAATGGAGG + Intergenic
1193829192 X:86267614-86267636 TTTTACAAATGAGGGAACTGAGG - Intronic
1193863980 X:86706333-86706355 TGTTATAAAGGACTGAAAGGAGG + Intronic
1193969153 X:88029962-88029984 TTTTACTAATGAATGAGCTGAGG - Intergenic
1195698537 X:107684646-107684668 TTTTACAAATGAAGAAACTGAGG + Intergenic
1195839316 X:109155436-109155458 TTTTCCAAAGGCTTGAACAGTGG - Intergenic
1196144428 X:112301308-112301330 TTTTACAAATGAGTAAACTGAGG - Intergenic
1196271659 X:113719331-113719353 TATTACAAAGGAATGTCTGGTGG - Intergenic
1197505410 X:127296678-127296700 TTTTAAAAAGCAATCAAGGGAGG + Intergenic
1197981483 X:132221880-132221902 CTTTACAAATGAAGGAATGGAGG - Intergenic
1198162189 X:134018832-134018854 TTTTACATATGAGTGAACTGAGG - Intergenic
1199188749 X:144946103-144946125 TTTTACAGATGAATAAACTGAGG + Intergenic
1199711376 X:150472036-150472058 TTTTACAAATGAAGAAACTGAGG + Intronic
1200374005 X:155760249-155760271 TTTTACAAATGAAGAAACTGAGG + Intergenic
1201577844 Y:15479270-15479292 TTTTACAAAGGAAGAAACTAAGG - Intergenic