ID: 900458561

View in Genome Browser
Species Human (GRCh38)
Location 1:2789403-2789425
Sequence CTATTTTACAAAGGAATGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 585}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900458561_900458565 7 Left 900458561 1:2789403-2789425 CCGTTCATTCCTTTGTAAAATAG 0: 1
1: 0
2: 3
3: 64
4: 585
Right 900458565 1:2789433-2789455 CACATCCGTCGCTACCTCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 23
900458561_900458567 18 Left 900458561 1:2789403-2789425 CCGTTCATTCCTTTGTAAAATAG 0: 1
1: 0
2: 3
3: 64
4: 585
Right 900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 43
900458561_900458569 27 Left 900458561 1:2789403-2789425 CCGTTCATTCCTTTGTAAAATAG 0: 1
1: 0
2: 3
3: 64
4: 585
Right 900458569 1:2789453-2789475 AGGAGACCCGCAGGAAGCAGCGG 0: 1
1: 0
2: 0
3: 30
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900458561 Original CRISPR CTATTTTACAAAGGAATGAA CGG (reversed) Intronic
900458561 1:2789403-2789425 CTATTTTACAAAGGAATGAACGG - Intronic
902815176 1:18912481-18912503 CTATTTTACAGATGAAGAAATGG + Intronic
903397425 1:23012572-23012594 CTACTTTATAAAGAAATGCATGG - Intronic
903607590 1:24586122-24586144 CTGTTTTACAAATGAAAGAGCGG + Intronic
904484932 1:30818387-30818409 ATATTTCTCAAACGAATGAATGG - Intergenic
904632728 1:31854935-31854957 ATGTTTCACAAGGGAATGAAGGG - Intergenic
905004032 1:34695977-34695999 CTACTTTACAGAGGAAGGACAGG + Intergenic
905411121 1:37768815-37768837 CTATTTTACAAAGAAAGAAGTGG - Intergenic
905518434 1:38578984-38579006 CTATTTTATAGAGGAGTAAACGG - Intergenic
906394224 1:45446854-45446876 CTAGTTTAAAAAAGAAAGAAGGG + Intronic
906414518 1:45610333-45610355 ATATTTTACAAAAGAAGAAATGG + Intronic
906512921 1:46421540-46421562 CCATTTTACAAAGGAGATAATGG - Intergenic
906799650 1:48725175-48725197 CTATATTAAAAAGAAATGGATGG - Intronic
906877505 1:49555155-49555177 CCATTTTACAAAGAACTGATTGG + Intronic
907836770 1:58116671-58116693 TTATTTTACAGAGGAAGAAATGG - Intronic
908149693 1:61287110-61287132 CTACTGTACCAAGAAATGAATGG - Intronic
908348526 1:63260787-63260809 CTATTTTATAAATGAAAGACAGG + Intergenic
908728846 1:67205448-67205470 CTATTTAACAAAGAACTCAAGGG - Intronic
908909800 1:69059981-69060003 CTATTATACTAATGAATGCAAGG - Intergenic
909472080 1:76040333-76040355 CCATTTTACAATGAAATGCAAGG + Intergenic
909497814 1:76298975-76298997 CTATTTTACTCAGGAAGAAAAGG + Intronic
910713168 1:90202861-90202883 CTAGTTTACAAAGAAAAGAATGG + Intergenic
911259812 1:95672325-95672347 CTATTTTTAAAAGGAAGAAAAGG + Intergenic
911417692 1:97596605-97596627 TTATTTTACAATGAAATGAAGGG + Intronic
911448247 1:98027621-98027643 CCATTTGAAAAAGAAATGAAGGG + Intergenic
911650500 1:100382708-100382730 CTATTTTAAAAAAGGATTAAAGG + Intronic
912728645 1:112081642-112081664 CCATTTTATAGAGGCATGAATGG + Intergenic
912753682 1:112306687-112306709 TTTTTTTAAAAATGAATGAATGG - Intergenic
912760634 1:112363495-112363517 GTTTTTTAAAAAGGAATGAAAGG + Intergenic
913005784 1:114629964-114629986 CTGATTTACAAAATAATGAAGGG + Intronic
913026760 1:114850972-114850994 CTAAGTTACATAGGAAGGAAGGG - Intergenic
913178548 1:116297713-116297735 CCATTTTACAAAGGGCTGATTGG + Intergenic
913351221 1:117862013-117862035 TTATTTTACAAATGAAGAAATGG - Intergenic
914672084 1:149878475-149878497 CCATTTTACAAAGAAAGAAATGG - Intronic
915762303 1:158327160-158327182 CTATTTTACAGAGCACTGATTGG + Intergenic
916121402 1:161531398-161531420 GAAGTTTACAAAGGAAGGAAGGG - Intergenic
916131171 1:161612978-161613000 GAAGTTTACAAAGGAAGGAAGGG - Intronic
917486334 1:175458324-175458346 ATATTGAACAAATGAATGAATGG - Intronic
917525509 1:175784911-175784933 CTATGCAACAAAGGAAAGAAAGG + Intergenic
917619088 1:176777071-176777093 TTATTTTACAAATGCAGGAAAGG - Intronic
917742735 1:177976581-177976603 CTATTTTACAGATGAAGAAAAGG - Intronic
917897833 1:179509616-179509638 TGATTTTATAAAGGAAAGAATGG + Intronic
917975845 1:180237135-180237157 AGATTTTGCAAAGGAAGGAAGGG - Intronic
918280719 1:183002342-183002364 CCATTTTACAAATGAAAGAATGG + Intergenic
918305134 1:183239301-183239323 CAAATTTACAAATGAGTGAAAGG - Intronic
918988310 1:191662197-191662219 CTATTTTACCGAGAAAAGAAAGG - Intergenic
919511161 1:198466320-198466342 CCATTTTATAAAGGAATGGACGG - Intergenic
920176151 1:204103156-204103178 CTATTTTACACATGAAGAAATGG + Intronic
920655689 1:207872916-207872938 CTATTTTTCATATGAATGCAAGG + Intergenic
920924382 1:210328432-210328454 CTAATTTACAAAGAAAAGCAGGG + Intronic
921240324 1:213174265-213174287 CCATTTTACAGATGAATAAAGGG - Intronic
921360952 1:214330816-214330838 CAAGGTTACAAAAGAATGAAAGG - Intronic
921701502 1:218273750-218273772 ATATTTTTCAAATGAGTGAATGG + Intergenic
921797382 1:219362321-219362343 CTATTTGACAAAGGAGCAAACGG - Intergenic
922184473 1:223261925-223261947 CCATTTTACAGAGGAAGAAATGG + Intronic
923739443 1:236642130-236642152 CTATTTTCCAAAGAAATTAATGG - Intergenic
1062817589 10:512066-512088 CCTTCTTACAAAGGCATGAACGG + Intronic
1063083931 10:2797251-2797273 CTATTCAAAAAAGGAAAGAAAGG + Intergenic
1063865290 10:10358372-10358394 ATCTTTTTCAAAGGAATGAAGGG + Intergenic
1064348481 10:14554740-14554762 CTACCTTACACAGGAAAGAAAGG - Intronic
1065453709 10:25884339-25884361 CTTTGTTCCAAAGGAAGGAATGG + Intergenic
1065609945 10:27463017-27463039 CCATTTTACAGATGAAGGAATGG - Intergenic
1066619259 10:37326576-37326598 CTATTTGGGAAAGAAATGAAAGG + Intronic
1067019755 10:42784600-42784622 CTATTTAAAAAAAGAATCAATGG - Intronic
1067819244 10:49512523-49512545 TTATTTTAAAAAAGTATGAAAGG + Intronic
1067904245 10:50274189-50274211 CCATTTTACAGATGAAAGAATGG - Intergenic
1069030100 10:63587257-63587279 GTATTTTGGAAAGAAATGAAGGG - Intronic
1069336268 10:67354904-67354926 CTTATTTGAAAAGGAATGAAGGG + Intronic
1069512354 10:69051991-69052013 CTATTTTCGATAGGAAAGAATGG + Intergenic
1069851281 10:71406731-71406753 CTATTTCCTAAATGAATGAATGG - Intronic
1070071885 10:73097505-73097527 CTATTTTACAGATGAGTAAACGG - Intergenic
1070089074 10:73266639-73266661 CTTTTTTAAAAAGTCATGAATGG + Intronic
1070094344 10:73322261-73322283 ATGTATTACAAAGGAATGAGAGG - Intronic
1070172855 10:73945567-73945589 CCATTTTACAAAGAACTGATAGG - Intergenic
1070196561 10:74162431-74162453 CCATTTAACAAAAAAATGAAAGG - Intronic
1070456538 10:76622798-76622820 ATATTTATCAAATGAATGAATGG + Intergenic
1071311043 10:84344334-84344356 ATATTTTACAAAAGTATTAAAGG + Intronic
1072155207 10:92717476-92717498 CTGTTATACAAAGCAATCAAGGG - Intergenic
1072483519 10:95831895-95831917 CTATTTGTTAAATGAATGAATGG - Intronic
1072557580 10:96533600-96533622 TTATTTTGCAAATGAAGGAAAGG + Intronic
1072647504 10:97268511-97268533 GTAATTTACAAAGGAAAGAGAGG + Intronic
1073237162 10:102026975-102026997 ATATTTGTCAAAAGAATGAATGG + Intronic
1073240453 10:102054650-102054672 CTAGTTTACAAAGCAACTAAAGG + Intronic
1073245883 10:102089848-102089870 CTATTTTACACAGGAGGAAATGG - Intergenic
1074913387 10:117932760-117932782 CTGTTTTACAAACCAGTGAAAGG - Intergenic
1075633543 10:124015643-124015665 TTATTTGCCAAATGAATGAATGG - Intronic
1075939593 10:126378808-126378830 ATATTTTAGAAATGAATGATGGG + Intronic
1078370757 11:10742796-10742818 TTATTTTACAGTGGAATAAAGGG - Intergenic
1078386387 11:10896613-10896635 CCATTTTACAAAGGAGGAAACGG - Intergenic
1078694071 11:13611983-13612005 CTATTTTACAGGTGAATAAATGG + Intergenic
1079119109 11:17667149-17667171 CAATATCACAAATGAATGAAGGG + Intergenic
1079316165 11:19409619-19409641 ATATTTGCCAAAGGAATGAACGG - Intronic
1079511180 11:21212212-21212234 CTATTTTCTAAATGAATAAATGG - Intronic
1079771458 11:24464932-24464954 ATATTTGTCAAATGAATGAATGG - Intergenic
1080135896 11:28854545-28854567 CTATTTCACAAATGAAGGAATGG + Intergenic
1080394092 11:31874058-31874080 CTCTTTTGGAAAGGAGTGAAAGG + Intronic
1080531996 11:33185514-33185536 ATATCTTACAAATGAATAAAAGG + Intergenic
1081523359 11:43904704-43904726 CTTTTTTCCAAAGGATTGAAAGG + Intronic
1081738002 11:45417913-45417935 CTATTTTACAAATGAGGGAATGG - Intergenic
1081746294 11:45474693-45474715 CTATTTTACAGAGGAGCAAATGG - Intergenic
1082032558 11:47616133-47616155 CTATTTTTTAAAGAAATAAAGGG - Intergenic
1082205584 11:49430137-49430159 CTTTTTTCCCAAGGCATGAAGGG - Intergenic
1084437112 11:69149497-69149519 CCATTTTACAAAGCACTGATTGG + Intergenic
1086331684 11:85760847-85760869 CCACTTTACAAAGGAGTGAAGGG + Intronic
1086649515 11:89270381-89270403 CTTTTTTCCCAAGGCATGAAGGG + Intronic
1087246106 11:95839323-95839345 TTATTTTTTAAAGGAATAAATGG - Intronic
1087960581 11:104343521-104343543 ATATTTTATAAATGAATAAAGGG + Intergenic
1088876203 11:113938608-113938630 TTATTGAACAAAGGAATAAAGGG + Intronic
1089747744 11:120628876-120628898 ATATTTTAAAAAGGAAGGAAGGG - Intronic
1089801988 11:121039561-121039583 ATATTTTAAAAATAAATGAATGG + Intronic
1090082043 11:123620048-123620070 CTATTTTATAAATGAAGAAATGG - Intronic
1090090541 11:123693434-123693456 CTATTTTTTAAATGAACGAATGG - Intergenic
1090879681 11:130822767-130822789 CTATTTTATAGAGGAAGGAATGG - Intergenic
1091230175 11:133983194-133983216 CTATTTTAAAAAGGAAGGGGTGG - Intergenic
1091500633 12:1014084-1014106 CTAATTTACACAGCAATTAATGG - Intronic
1091573245 12:1710149-1710171 CCATTTTACAAAGCACTGATTGG - Intronic
1091820535 12:3472352-3472374 CTGTTTGATAAATGAATGAATGG + Intronic
1092101581 12:5888501-5888523 CTATTTTACAGAGAGCTGAATGG + Intronic
1092391008 12:8079238-8079260 GCATCTTACCAAGGAATGAACGG + Intergenic
1092748773 12:11698671-11698693 CTATCTTACAAAGGTATTAGGGG - Intronic
1093563710 12:20576886-20576908 GAATTTTACAAAGAAATAAAAGG + Intronic
1095580708 12:43793608-43793630 CTAATTAACAAATAAATGAATGG + Intergenic
1095676919 12:44931109-44931131 CTTTTATACAAAGGAAGGAAGGG + Intergenic
1096712015 12:53464537-53464559 CTATTTTCAATAAGAATGAAGGG - Intronic
1096913946 12:55012229-55012251 CTGTTTTATAAATGAATTAATGG - Intergenic
1096966722 12:55633748-55633770 CTGTTTTACTAAGAGATGAAAGG + Intergenic
1096987643 12:55771754-55771776 CTGATTTCCAAAGGAATGTAAGG + Intronic
1097778303 12:63673456-63673478 CTATTTTTCAAAGGCAAAAATGG - Intergenic
1098704577 12:73671552-73671574 CTCCTTTCCAGAGGAATGAACGG - Intergenic
1099351156 12:81570326-81570348 GGATTTTTCAAAGGAATAAATGG - Intronic
1099361965 12:81714358-81714380 ATCTATTACAAAGGTATGAAAGG + Intronic
1099477943 12:83130827-83130849 GTATTTCACAAATGAAGGAAGGG + Intronic
1100142475 12:91634815-91634837 CTATTTTACAGAGAAATGATTGG - Intergenic
1100211546 12:92403828-92403850 CTAATTTTCAGAGAAATGAATGG - Intergenic
1100726528 12:97414609-97414631 CAATTTGACAAAGAAAGGAAGGG - Intergenic
1101304659 12:103515821-103515843 CTATTTTTTAAAAGAAAGAAGGG + Intergenic
1102565835 12:113796969-113796991 GTATTTTACACAGGATGGAAGGG + Intergenic
1102776448 12:115524003-115524025 CCATTTTATAAAAGAATGAAGGG - Intergenic
1103755651 12:123204555-123204577 TTATTTTACTAATGAATAAAGGG - Intronic
1103837586 12:123835544-123835566 CTATTTTAGTAATGAAAGAAGGG + Intronic
1104520479 12:129469943-129469965 ATATCTTACAAAGGCTTGAAGGG - Intronic
1105312743 13:19227731-19227753 ATATTTTACAAAGGAAAGTCTGG + Intergenic
1105364455 13:19752069-19752091 ATATTTTACAAAGGAAAGTCTGG + Intronic
1105475628 13:20726034-20726056 TGATTTTAGGAAGGAATGAAAGG + Intergenic
1105488849 13:20866811-20866833 ATATTCTAAAAAGGAAAGAATGG + Intronic
1107005353 13:35603505-35603527 ATATTTTATACAGGAAAGAATGG + Intronic
1107333146 13:39323354-39323376 CTATCTCCCAAAGTAATGAAAGG + Intergenic
1107711592 13:43155805-43155827 TTATTGAACAAATGAATGAATGG - Intergenic
1107845462 13:44508169-44508191 CTATTTTACATAGGAAGAATGGG - Intronic
1108192077 13:47951974-47951996 TTTTTTTACAAAGGCATGGAAGG - Intronic
1108529946 13:51319414-51319436 CTGTTTTACAGAGGAATCAGAGG + Intergenic
1108612714 13:52099776-52099798 CTATATTGCATAGAAATGAATGG - Exonic
1109081716 13:57910925-57910947 GAATTTTAAAAAGGAAAGAAAGG + Intergenic
1109686342 13:65824855-65824877 GTATTTCACAATGGAATGGAAGG - Intergenic
1109735543 13:66479831-66479853 CTATTTTACAGAGCACTGATTGG - Intronic
1109872288 13:68348718-68348740 CTATTTGAAGTAGGAATGAATGG + Intergenic
1110228045 13:73140460-73140482 CTATTTTAAAAAAGAAAAAAAGG - Intergenic
1110564954 13:76948760-76948782 CTATTGTACAAAGTTAGGAAGGG + Intronic
1111030082 13:82585494-82585516 GTATTTTACATATTAATGAAGGG + Intergenic
1111080993 13:83307527-83307549 TGATTCTACAAAGGAAGGAATGG - Intergenic
1111280537 13:86017036-86017058 CTTTTCCACAAAGGAATGACAGG + Intergenic
1111318940 13:86598487-86598509 CCATTTTACACAGGAGTGAAGGG - Intergenic
1111461219 13:88544967-88544989 CCATTTTACTAATGAATGAGAGG + Intergenic
1111564310 13:89994766-89994788 GGATATTACAAAAGAATGAAAGG + Intergenic
1111894464 13:94124110-94124132 TTATTTTTCAAAGGAATATACGG - Intronic
1112287829 13:98119438-98119460 CTTTTTTAAAAAAGAAAGAAAGG - Intergenic
1112557124 13:100478820-100478842 CTACTATAAAAAGGAAAGAATGG + Intronic
1112691589 13:101901848-101901870 TTATTTTTCAAACGAAAGAATGG - Intronic
1112884290 13:104149175-104149197 CTATATTAGGAAGGAATGAGGGG + Intergenic
1113098607 13:106692838-106692860 TTATTTTAAAAATGAATGCAAGG - Intergenic
1113108225 13:106794091-106794113 CTATATTACAAATGAATGCCAGG - Intergenic
1113421032 13:110171680-110171702 CTATTTCACACAGCAATGAGTGG + Intronic
1114074210 14:19145995-19146017 CTGTTTAATAAAAGAATGAATGG - Intergenic
1114088058 14:19253980-19254002 CTGTTTAATAAAAGAATGAATGG + Intergenic
1114365052 14:22017022-22017044 ATATTTTACAAATATATGAATGG + Intergenic
1115011347 14:28549953-28549975 CTTCTGTATAAAGGAATGAATGG - Intergenic
1115348467 14:32367571-32367593 ATATTTTAAACAGGAATGGATGG + Intronic
1115838464 14:37437583-37437605 GTATCATACAAAAGAATGAATGG - Intronic
1115849458 14:37578106-37578128 CCATGAAACAAAGGAATGAAAGG + Intergenic
1115948429 14:38692501-38692523 TTATTTTAAAAAGGAATGGCAGG - Intergenic
1116207710 14:41889660-41889682 CTATTTTACAAATGACAAAAAGG - Intronic
1116392677 14:44412426-44412448 CTATGTTAAAGAGAAATGAATGG - Intergenic
1116710754 14:48365763-48365785 CTATTTTATAAAGGGAAAAATGG - Intergenic
1116780702 14:49234813-49234835 CTATTTAACATAGTAATGAAAGG - Intergenic
1116992125 14:51287595-51287617 CTTTTTTTAAAAGAAATGAATGG + Intergenic
1117544070 14:56776965-56776987 TTTGTTTACAAAGGAAAGAAAGG - Intergenic
1117718940 14:58609328-58609350 CCATTTTGAAATGGAATGAAAGG - Intergenic
1118444124 14:65836582-65836604 ATATTTGTCAAATGAATGAATGG - Intergenic
1118584209 14:67337051-67337073 CTATTTTACAGAGGAAAAATTGG - Intronic
1119160525 14:72448551-72448573 CCATTTTGCAAATGAATGGAAGG - Intronic
1119495924 14:75079131-75079153 CTATTTTACTAAGTAACAAATGG + Exonic
1120528256 14:85602790-85602812 CCATTTTAAACAGAAATGAAGGG - Intronic
1120589428 14:86357804-86357826 CTATTTTCCAGAGAAATTAAGGG - Intergenic
1120658863 14:87229480-87229502 ACATTTTACAAAGGAATCAATGG - Intergenic
1121613719 14:95298807-95298829 CTATATTACAGAGGAAGAAAGGG + Intronic
1121945032 14:98111803-98111825 TTATTTTACAACGGAACAAAAGG + Intergenic
1122091445 14:99343531-99343553 CCATATTCCAAAGGACTGAATGG + Intergenic
1123727256 15:23115396-23115418 ATATTTTACAAAAGACAGAATGG + Intergenic
1123797663 15:23789027-23789049 CCATTTTACAAAGGAGTAACAGG - Intergenic
1124923203 15:34046683-34046705 CTCTCATGCAAAGGAATGAAAGG + Exonic
1124988651 15:34648655-34648677 CTATTTTAAACACGAATGAATGG - Intergenic
1125240915 15:37574773-37574795 CTATTTTACAAATGAATAAATGG + Intergenic
1125260670 15:37821277-37821299 ATATTTTACAAGGGAAGGGAGGG + Intergenic
1125295084 15:38194021-38194043 TTATTTTACAAGGCAATGGAAGG + Intergenic
1125298502 15:38228947-38228969 ATATTCTACTAAGAAATGAAGGG + Intergenic
1126058392 15:44754449-44754471 TTTTTTTAAAAAGGAGTGAAGGG + Intronic
1126129700 15:45328257-45328279 CAATATTACAAAGAAATGAAGGG + Intergenic
1126964062 15:54031091-54031113 TCATTCTACAAAGCAATGAAAGG - Intronic
1127540119 15:59929208-59929230 CTATTTTTCAGATGAATAAATGG - Intergenic
1127585050 15:60370526-60370548 CAATTTTTCACAGGAATAAATGG - Intronic
1127818580 15:62634985-62635007 AGAATTGACAAAGGAATGAATGG - Intronic
1128204391 15:65837914-65837936 CTATTTTTTAAAGGACAGAATGG - Intronic
1129307797 15:74680444-74680466 CTTTTTAAAAAAAGAATGAATGG - Intronic
1129611350 15:77060843-77060865 CCTTTTTACAAAGAAGTGAAAGG + Intronic
1129615462 15:77095902-77095924 CTATTTTCCAAAACAATGTATGG - Intergenic
1129809812 15:78500711-78500733 CTCTTATACAATGGAATCAATGG + Exonic
1129987513 15:79931410-79931432 CAATTTTACAAAGGAATCCCAGG + Intergenic
1131624648 15:94104573-94104595 GTAATTTATAAAGGAAAGAAAGG - Intergenic
1131696843 15:94886407-94886429 TTATTTTTAAAAGGAATGAAGGG + Intergenic
1133157170 16:3883267-3883289 CCATTTTACAGAGGAAAGCAAGG + Intergenic
1133330738 16:4971821-4971843 ATATTTCTCAAAGGAATGAAAGG - Intronic
1134436515 16:14263620-14263642 CTATTTTAAAAAGCAATAAAGGG - Exonic
1134852144 16:17488556-17488578 GTAATTTATAAAGGAAAGAAAGG + Intergenic
1135033605 16:19058458-19058480 CTATTTTACAAATGAGGAAATGG + Intronic
1135278281 16:21132166-21132188 GTATTTTAAAAAGGAATTGAGGG - Intronic
1137766016 16:50978193-50978215 CTTTTTTACAAAGGGTTGGATGG + Intergenic
1138087555 16:54146950-54146972 ATTTTTTAAAAAGGAATGAAGGG - Intergenic
1138292264 16:55857813-55857835 CTATTTCACAGATGAAGGAATGG + Intronic
1138783895 16:59822652-59822674 CTATTTTATAAAGTGATGACAGG + Intergenic
1139074038 16:63421206-63421228 CCATTTTACAAATGAAGAAATGG + Intergenic
1139319356 16:66101011-66101033 CCATTTTACAAATGAAGAAATGG + Intergenic
1140105370 16:71955121-71955143 CTATTTTTCAATGAAATTAATGG - Intronic
1140311183 16:73850038-73850060 TTATTTTTAAAAGGAAGGAAGGG + Intergenic
1140399655 16:74660757-74660779 TTACTTCACAAAGTAATGAAGGG - Intronic
1140557043 16:75933782-75933804 CTAGATTATAAAGAAATGAATGG - Intergenic
1141249201 16:82339494-82339516 TTCTTTTCCCAAGGAATGAAGGG - Intergenic
1142237006 16:88927164-88927186 CTATTTGTCGAGGGAATGAACGG + Intronic
1143198497 17:5095834-5095856 CTAATGTTCAAATGAATGAATGG - Exonic
1143831527 17:9655753-9655775 ATATTTATCAAAGGAATGAAGGG + Intronic
1143893394 17:10118985-10119007 GTATTTGTCAAATGAATGAATGG - Intronic
1145754738 17:27382152-27382174 GTCTTTTACAGAGGAATAAATGG + Intergenic
1145966909 17:28925728-28925750 CCATTTTAGAAAGGAAGAAACGG - Intronic
1146218957 17:31001878-31001900 CCATTTTAGAGAGGAAAGAAAGG - Intergenic
1146395143 17:32459218-32459240 CTATTTGTCAAAGGAATGTATGG + Intronic
1147358550 17:39916828-39916850 TTATTTTACAAGGGAAAAAATGG + Intronic
1148077362 17:44946261-44946283 CTTTTTTAAAAAGGTATAAATGG + Intronic
1148997343 17:51722694-51722716 CTATTTTCCAAATGAGAGAATGG + Intronic
1149406901 17:56361541-56361563 CCATTTTACAAATGAAGAAATGG - Intronic
1149547189 17:57512270-57512292 TTTTTTTTCAAATGAATGAATGG + Intronic
1150187602 17:63200990-63201012 TTATTTTAAAAAGGAAAAAAAGG - Intronic
1150961512 17:69917903-69917925 CTAGTTTTTAAAGGATTGAAGGG - Intergenic
1152674917 17:81634886-81634908 TTATTTTTCAAAGGAGTCAAAGG + Intronic
1152993398 18:383788-383810 ATAATTTATAAAGGAAAGAAAGG + Intronic
1153918120 18:9764231-9764253 AAACTTTACAAAGGAATCAAAGG - Intronic
1154220900 18:12453331-12453353 CTATTTTAAAAGGTAATAAAAGG + Intronic
1154390910 18:13935216-13935238 CCATTTTACAGATGAAGGAATGG - Intergenic
1155876597 18:31097589-31097611 ATTTTTTAAAAAGCAATGAAAGG + Intronic
1156520061 18:37714435-37714457 CTACTTCACAAATGAACGAATGG + Intergenic
1156718843 18:40045396-40045418 CTATTTTACAGAGGAAAGCCAGG - Intergenic
1156852430 18:41744009-41744031 CAATTTTGCAAAGTAATAAAGGG + Intergenic
1156870111 18:41936324-41936346 CTATTTTCTAAAGGAAGAAAAGG - Intergenic
1156942940 18:42792774-42792796 TTATTTTACAAATGAATTTATGG - Intronic
1157999643 18:52602014-52602036 CAATTTTTCAAAGAAATTAAAGG + Intronic
1159035316 18:63271832-63271854 CTCTGTTTCAAAGGAAAGAAAGG - Intronic
1159295398 18:66480260-66480282 TTATTGTACAAATGACTGAAAGG - Intergenic
1159446039 18:68542823-68542845 TTATTTTAAAAATAAATGAAAGG + Intergenic
1160246892 18:77166299-77166321 TTATGTTTCAAAGGAATGACCGG + Intergenic
1162341328 19:10093041-10093063 TTCTTTGATAAAGGAATGAACGG - Exonic
1162519110 19:11168700-11168722 ATATTTTTCAAATGAGTGAATGG + Intronic
1162626679 19:11890048-11890070 CTATTTCAGAATAGAATGAATGG + Intronic
1166628306 19:44381709-44381731 CTTTTTTGGAAAGAAATGAAGGG + Intronic
1166872654 19:45880243-45880265 CTATTTTAGAAAGGGATGTAGGG - Intergenic
1168358547 19:55718437-55718459 CTATCTCAGAATGGAATGAATGG - Intronic
925555827 2:5130828-5130850 TTAATTTACAAATAAATGAATGG + Intergenic
925673612 2:6337515-6337537 CAATTTTACAAAGACATGATTGG - Intergenic
926983747 2:18598837-18598859 CTATTTTACAAATGAGGAAATGG - Intergenic
927234028 2:20853383-20853405 ATATTTTAGAATGGAAAGAAAGG + Intergenic
927326187 2:21807982-21808004 TTATTTTAAAAAGTAATGGAAGG + Intergenic
927609172 2:24520160-24520182 CTATTTTCCAAAGTAGTGTATGG - Intronic
927922109 2:26981022-26981044 CTATTTTACTAAAGAAAGAAAGG - Intronic
928413087 2:31069480-31069502 CCATTTTACAAATGAAGAAATGG + Intronic
928583961 2:32739140-32739162 TTGTTTAACAAAGGAATGAATGG + Intronic
930000701 2:46859791-46859813 CCATTTTACAAAGGTATGGGTGG + Intergenic
930133624 2:47878669-47878691 TTTTTTTTTAAAGGAATGAAAGG + Intronic
930725537 2:54677842-54677864 CTGTTTGTCAAAGGAATAAATGG + Intergenic
930815297 2:55590533-55590555 CTAAATTACAAAGGAAAAAATGG + Intronic
931338389 2:61373847-61373869 CTATTTTACAAAAGAGAAAATGG + Intronic
931935055 2:67187556-67187578 ATATTTTTTGAAGGAATGAATGG - Intergenic
932815848 2:74861124-74861146 CCATTTTAAAAGGGAATGCAGGG + Intronic
933092779 2:78142515-78142537 ATATTTTCCAAAGTAAAGAATGG + Intergenic
933116805 2:78484082-78484104 CTACTTAACAGAGAAATGAAAGG + Intergenic
933478128 2:82818718-82818740 CTGTTTCACGAAGGCATGAAAGG - Intergenic
933861296 2:86471744-86471766 GCAATTTACAAAGGGATGAATGG - Intronic
934052912 2:88225274-88225296 CTAGTTTTTAAATGAATGAATGG + Intergenic
934068954 2:88365983-88366005 AATTTTTAAAAAGGAATGAAGGG + Intergenic
934115356 2:88785614-88785636 CTATTTTAGAAAGAAAATAATGG + Intergenic
935217457 2:100985584-100985606 CTGTTTGATAAATGAATGAATGG - Intronic
935638656 2:105270158-105270180 CTACTTTACATTGGAATAAAGGG - Intronic
935809991 2:106788292-106788314 CTATTGAAAAAGGGAATGAATGG + Intergenic
936374868 2:111931861-111931883 CTATTTTCCAAAGGAAGAGATGG + Intronic
936492184 2:112981696-112981718 AAATTTTAAAAAGCAATGAAGGG - Intronic
936769549 2:115895085-115895107 CCCTTTTCCAAGGGAATGAAAGG + Intergenic
936983551 2:118287152-118287174 CTATTTTTAAAAGGGATGAAGGG + Intergenic
938198879 2:129356766-129356788 CTATTTTCACAAGGACTGAAGGG - Intergenic
938488539 2:131742497-131742519 CTGTTTAATAAAAGAATGAATGG - Intronic
938545284 2:132323481-132323503 CTTTTTTGGAAAGAAATGAAGGG - Intergenic
938751529 2:134335623-134335645 CTATCTGAGAAAGAAATGAAAGG - Intronic
938849587 2:135247150-135247172 CTATTTTACAAATGGGTGATTGG + Intronic
939553423 2:143643687-143643709 CTATTTTGCAAAAGAATAAAAGG + Intronic
939754121 2:146088332-146088354 ATATTTAAGAAAGGAATGGAAGG - Intergenic
939871638 2:147532766-147532788 CTATTTTACAAATGAGAAAAGGG + Intergenic
940496458 2:154434983-154435005 CTCTTTTATAATGGAAGGAAAGG + Intronic
940518299 2:154709944-154709966 TAATGTTACAAAGAAATGAAAGG - Intronic
940636388 2:156302574-156302596 TTATTTTACAAAGGAATTTGAGG + Intergenic
940980309 2:159994177-159994199 TTATTTTTAAAAAGAATGAAAGG - Intronic
941319436 2:164036288-164036310 CTCTTTTACAAAGCCATGTAGGG - Intergenic
943076041 2:183196327-183196349 TTGTTTTACAAAGGAATATAAGG - Intergenic
943474208 2:188334328-188334350 CTGTTTTACAAAGGAGGAAATGG + Intronic
943581290 2:189686110-189686132 ATAAATTACAAAGAAATGAAAGG - Intronic
943667521 2:190625582-190625604 TTATTTTATAAAAGAAAGAAAGG + Intergenic
944298321 2:198092692-198092714 CTATGTGACAAAGGAATGTATGG - Intronic
944352726 2:198747877-198747899 ATATGGTATAAAGGAATGAAGGG + Intergenic
944825714 2:203481327-203481349 CTCTTTTACAATGGAAGGAACGG - Intronic
944970634 2:204988887-204988909 CTATTTAACAATGAAAAGAATGG + Intronic
946113654 2:217443024-217443046 CTATTTTAAAAAATAATAAATGG - Intronic
946907080 2:224427915-224427937 AATTTTTACAAATGAATGAATGG + Intergenic
947959155 2:234220399-234220421 TTTTTGTTCAAAGGAATGAAAGG - Intergenic
948724147 2:239921522-239921544 CCATTTTACAGAGCAATGATTGG + Intronic
1169795308 20:9456223-9456245 CTATTTTTGAAACAAATGAAAGG + Intronic
1170099621 20:12684481-12684503 CAGTTTTACAAATGAATGAATGG - Intergenic
1170608657 20:17894098-17894120 CTGTTTTACAGAGGACTCAAAGG - Intergenic
1170739834 20:19046313-19046335 GTAATTTACAAAGGAAAGATAGG + Intergenic
1171399226 20:24860925-24860947 GTAGTATACAAAGGAATGGAGGG - Intergenic
1171874138 20:30556243-30556265 CTTTTTTGGAAAGAAATGAAGGG - Intergenic
1172799324 20:37565005-37565027 CCATTTTACAGATGAATAAATGG - Intergenic
1173058031 20:39635412-39635434 CCATTTTACCAATGAATAAATGG + Intergenic
1173105744 20:40132383-40132405 CTTTTTCACAAATGACTGAAAGG - Intergenic
1173144543 20:40513422-40513444 CCACTTTACAGAGGAAGGAAAGG + Intergenic
1174347508 20:49941237-49941259 CCATTTCACAAAGGAAAAAATGG + Intronic
1174769324 20:53283717-53283739 CTATTTTACAGTTGAAGGAATGG + Intronic
1174834924 20:53848086-53848108 CTATTTTACACAGGAGAAAATGG - Intergenic
1174895670 20:54447391-54447413 CTTGTTTACACAGGAATGAGTGG + Intergenic
1174996809 20:55578768-55578790 CTACTTTACAAATGAAGAAAAGG - Intergenic
1175005635 20:55679250-55679272 CTTTTCTACAAAGCAATTAAAGG - Intergenic
1175326397 20:58131499-58131521 GTTTTTTGCAAAGGAATCAAGGG - Intergenic
1175380927 20:58563446-58563468 CAATGTTAGAGAGGAATGAAGGG + Intergenic
1176922866 21:14709757-14709779 CTTTTTTAAAAAAGAATCAACGG + Intergenic
1177062030 21:16388022-16388044 CTATTTTTCAAAGGATATAATGG - Intergenic
1177579309 21:22998925-22998947 AAATTTTACAAATGCATGAAGGG + Intergenic
1177625700 21:23656710-23656732 AAATTTTACCAAGGAAAGAATGG + Intergenic
1177711629 21:24783247-24783269 CTATTTAACAAATAAATTAATGG + Intergenic
1178922856 21:36750394-36750416 CTGCTCTACAAAGGTATGAATGG - Intergenic
1180289854 22:10838935-10838957 CTGTTTAATAAAAGAATGAATGG - Intergenic
1180492651 22:15868357-15868379 CTGTTTAATAAAAGAATGAATGG - Intergenic
949105271 3:195751-195773 ATATTTTGAAAATGAATGAATGG - Intergenic
949275218 3:2271473-2271495 CTATTTAACAAATGAAGAAATGG - Intronic
950638122 3:14330409-14330431 CTATTTTAGGAAGGAATTAGGGG - Intergenic
950737892 3:15025505-15025527 CCATTGTACACAGGAAGGAATGG - Intronic
951841010 3:27034222-27034244 CTATTTTACTAAGGGATGTTAGG + Intergenic
951860252 3:27244278-27244300 CTATTTTACAGAAGAATTAAAGG + Intronic
951982362 3:28579543-28579565 GAATTTTAAAAAGCAATGAAAGG - Intergenic
952684179 3:36130669-36130691 CCATTGTACAAAGGAATATAAGG - Intergenic
952694107 3:36245693-36245715 CTAAATTACCAAGAAATGAATGG + Intergenic
953134801 3:40173226-40173248 CCATTTTACAAAGGAATAAACGG + Intronic
953298559 3:41748716-41748738 ATATTTTACAAAAGACAGAATGG - Intronic
954447358 3:50553865-50553887 CCATTTTACAAATGAGTCAATGG + Intergenic
955047347 3:55372695-55372717 CTATTTACCAAATAAATGAATGG + Intergenic
955196257 3:56807221-56807243 TTATTTGATAAATGAATGAACGG - Intronic
955690645 3:61587139-61587161 CTATTTTACACAATAATGTAGGG - Intronic
955822349 3:62909528-62909550 CTATTTTAAAAAACAATAAAAGG + Intergenic
956112734 3:65886119-65886141 CTATTTCTCAATGGAATGAAAGG - Intronic
956542190 3:70352761-70352783 TTATTTTCCAAAGGAAAAAAAGG + Intergenic
956582468 3:70829730-70829752 ATATTGTACAATGCAATGAAAGG + Intergenic
957617122 3:82544533-82544555 ATTTTGTACAAAGGAATGCATGG - Intergenic
959205247 3:103298593-103298615 GTATCTTAAAAAGAAATGAATGG - Intergenic
960022707 3:112973508-112973530 CCATTTTACAAAGGTAGAAATGG - Intronic
960435412 3:117620631-117620653 CTAGTTTACCAAGTTATGAAAGG - Intergenic
960664840 3:120098691-120098713 CTATTATAAATAGGAATGCATGG - Intergenic
960883585 3:122371388-122371410 CTTATGTACAAAGGAATGAAAGG - Intronic
961199200 3:125030730-125030752 CCATTTTACATAGGAAGCAAAGG + Intronic
961950256 3:130742213-130742235 CTCTTTTTCAAAGGAACGGAAGG + Intronic
962086191 3:132194356-132194378 ATATTTAATAAAGGAATCAATGG - Intronic
962562658 3:136623585-136623607 TTATTTTATAAAGTCATGAAGGG + Intronic
963412662 3:144951462-144951484 ATGTTTTAGAAAGGAATGAAAGG + Intergenic
963734235 3:149001947-149001969 TCATTTTACAAATGAAGGAATGG + Intronic
964303309 3:155313251-155313273 GGAATTTAGAAAGGAATGAAGGG - Intergenic
964622221 3:158729750-158729772 CCATTTTAAAAAGGAATAATAGG - Intronic
964805688 3:160607413-160607435 CAATTTTCCTAAGGAAAGAAAGG + Intergenic
964938015 3:162118124-162118146 CTAGTTTTCAAAAGAATAAAAGG - Intergenic
964988779 3:162779584-162779606 CTCTTTTAAAAGGGAAAGAATGG + Intergenic
965825406 3:172724302-172724324 CTCTTTTACAAAGAAGAGAAGGG + Intergenic
965900165 3:173630011-173630033 CTATTTTACAGACAAAGGAAAGG + Intronic
965934047 3:174083284-174083306 CCATTTTATACATGAATGAATGG - Intronic
967293945 3:187947615-187947637 TTTTTTAACAAAGGAAGGAAAGG + Intergenic
967775963 3:193386344-193386366 CTATTTTACAAAAGAATCTTTGG + Intergenic
969245535 4:5930253-5930275 CTATTTTCCAAAGAAATGGAAGG - Intronic
969263418 4:6047978-6048000 ATATTTGTCAAATGAATGAATGG + Intronic
970616258 4:17770984-17771006 CTCTTTGTCTAAGGAATGAAAGG + Intronic
971227793 4:24770820-24770842 CTCTTTTATAAAGGAGAGAAGGG + Intergenic
971260877 4:25055714-25055736 CTAGTTTGGAAAAGAATGAACGG - Intergenic
971544724 4:27870700-27870722 CTATTTCACTAAGTAGTGAAAGG + Intergenic
972443626 4:39121247-39121269 TTAATTTACTAAGAAATGAAAGG - Intronic
972651469 4:41021628-41021650 CCATTTTACAGAGCACTGAACGG - Intronic
972752294 4:42002976-42002998 CTACTTCAGAAAGGAAGGAAGGG - Intronic
972996697 4:44888097-44888119 CCATTTTATAATGGAATGATTGG + Intergenic
973653637 4:53022915-53022937 TTATTGTATAAATGAATGAATGG + Intronic
974088336 4:57284614-57284636 CAATTTTACAAAGCAAAGGAGGG - Intergenic
974383645 4:61176297-61176319 CCATTTTGCAAAGGAATATAAGG + Intergenic
974436905 4:61868501-61868523 CTCTATAACAAACGAATGAAAGG + Intronic
975049007 4:69836229-69836251 CTTTTTTACATGGGACTGAATGG - Intronic
975244237 4:72100215-72100237 ATATTTTACAAATGAAGAAATGG + Intronic
975270474 4:72426540-72426562 ATATTTTACAAATCAATGAAAGG - Intronic
975464067 4:74689404-74689426 CCATTTTAAAAAGGAAGAAATGG - Intergenic
975888009 4:78988960-78988982 CTATTTTCCAGAAGATTGAAGGG + Intergenic
976099175 4:81542317-81542339 CTATTTCAGGAAGGGATGAATGG - Intronic
976173990 4:82334109-82334131 CCATTTTACAAAGCACTGATTGG + Intergenic
976329746 4:83815895-83815917 ATATTTTTTAAATGAATGAATGG + Intergenic
976351543 4:84065714-84065736 GTCTTATAAAAAGGAATGAATGG + Intergenic
976695522 4:87916028-87916050 ATAGTTTCCAAAAGAATGAATGG + Intergenic
976749755 4:88442370-88442392 GTATTCTACAATGGAAAGAATGG + Exonic
976980081 4:91216793-91216815 CCATTTTACCAATGAGTGAAAGG + Intronic
977365620 4:96064371-96064393 AAATTTTAAAAATGAATGAATGG - Intergenic
977539759 4:98302743-98302765 ATTATTTACAAAGGAAAGAAAGG + Intronic
977990630 4:103436724-103436746 ATATTTTACAAGGAAATGTAGGG - Intergenic
979119686 4:116882090-116882112 TTATTTTACAGAGGAGTTAACGG + Intergenic
979177792 4:117686035-117686057 CTTTTTTTTAAGGGAATGAAAGG - Intergenic
980023169 4:127732896-127732918 CTACTTTACAATGGTATGAAAGG + Intronic
981065992 4:140486311-140486333 CTATCTTACAAAGGATGGCAGGG - Intronic
981084224 4:140666643-140666665 CTATTTTCCAAATGGATAAAAGG + Intronic
981354223 4:143768603-143768625 CTATTTTACAAAGTAGGGTAAGG + Intergenic
981803023 4:148680164-148680186 CTATTGTGCAAAGGAAAGGAAGG + Intergenic
981885223 4:149666126-149666148 CCATCTTACCCAGGAATGAAGGG - Intergenic
982310267 4:153977386-153977408 TTATTTTAGAAAGAAATGAAAGG - Intergenic
982520785 4:156414406-156414428 CTATTTTAGAAAGAGATTAAAGG + Intergenic
982558613 4:156900828-156900850 CTGTCTCAAAAAGGAATGAAAGG + Intronic
982815644 4:159880449-159880471 CCATTTTACAAAGAAATGTTAGG + Intergenic
983123833 4:163924241-163924263 CTCTTTTAGAAAGTAATCAAAGG + Intronic
983717028 4:170795362-170795384 CTATTTTATAAAGGGTTGAGGGG - Intergenic
983840616 4:172453336-172453358 GAATTTTAAAAAGGAATGCATGG + Intronic
984113962 4:175655054-175655076 CTACTTTACAAGGCAATGAAAGG + Intronic
984387313 4:179077529-179077551 GTATTCTACATAAGAATGAATGG + Intergenic
985213392 4:187620068-187620090 CTTTTTCAGAAAGCAATGAAGGG + Intergenic
986738221 5:10683006-10683028 CTATTTTCCAGAGGGATCAATGG + Intronic
986739517 5:10693964-10693986 CTATTTTACGGAGGAAGAAATGG + Intronic
987501495 5:18715850-18715872 CTATTTTTCAAAGGAAAGCCAGG - Intergenic
987972981 5:24975092-24975114 CTATCTTACAAAGGAAGGAGTGG - Intergenic
989716819 5:44473126-44473148 CTATTTTACCAAGGCATTACTGG - Intergenic
989744871 5:44816880-44816902 CTATTTTAAAAATGAAGGAGCGG - Intronic
989825193 5:45846546-45846568 CTAATTTACAAATGAAAGTATGG + Intergenic
991320459 5:65367995-65368017 TTATTTCACAAAGTAATCAAAGG + Intronic
991592504 5:68268130-68268152 CCATTTTACAGATGAATAAATGG + Intronic
992157358 5:73968562-73968584 CTATTTTACAGATGAAGAAAAGG + Intergenic
992396421 5:76373122-76373144 CTATTTGTCAGATGAATGAATGG - Intergenic
992405460 5:76453222-76453244 CTATCTTAAAGAGGAATGCAGGG + Intronic
992785686 5:80168522-80168544 CTATTTTAGAAATGATTCAAGGG + Intronic
992942243 5:81773833-81773855 CTATTTTACACATGACAGAATGG - Intergenic
993267965 5:85751877-85751899 CTATTTTTCAAAGTAATCATGGG + Intergenic
993626937 5:90236872-90236894 CTATTTTCCAAGTTAATGAAAGG - Intergenic
993979175 5:94523058-94523080 TAATTTTACAAAGTAATAAAAGG - Intronic
994178907 5:96742575-96742597 GTATTTTACAAAGAAGTAAATGG + Intronic
994275593 5:97832990-97833012 CTAGTTTTCAAGGGAAGGAATGG - Intergenic
994477721 5:100291331-100291353 CTTTTTTCAAAAGGAAAGAAGGG + Intergenic
994541458 5:101103726-101103748 ATATATTACAAAAGAATCAAAGG + Intergenic
994743543 5:103650863-103650885 CTCTTTTCTAAAGGAGTGAATGG - Intergenic
994781217 5:104093288-104093310 CTATTTTATATAAGCATGAATGG + Intergenic
994932614 5:106208078-106208100 CTATTATCCAAAATAATGAAAGG - Intergenic
994981622 5:106881631-106881653 ATATTTTATGAATGAATGAATGG + Intergenic
995466657 5:112456786-112456808 ATATTTGACAAAGGAAGGGAAGG + Intergenic
996602315 5:125278654-125278676 CTATATGCCAAGGGAATGAAGGG - Intergenic
996704660 5:126484926-126484948 CTATAATACAAAGGGAGGAAAGG - Intronic
996712487 5:126557081-126557103 ATATTTTACCATGTAATGAAGGG + Intronic
996873789 5:128219168-128219190 CCATTTTACCAATGAAGGAACGG + Intergenic
997774120 5:136584104-136584126 TTATTTTATAAAGGGATGCATGG + Intergenic
997849170 5:137315525-137315547 CTGTTTTACACAGGAGAGAAAGG + Intronic
999528873 5:152439474-152439496 CTATTTCACAAATGAGGGAAAGG + Intergenic
999642556 5:153686521-153686543 TAATTTTGCAAATGAATGAATGG - Intronic
999793987 5:154970499-154970521 CTACTTTGGAAAGGAAGGAATGG + Intergenic
1000301705 5:159962528-159962550 CTATTTTACAGATGAAGAAATGG - Intronic
1000678277 5:164150845-164150867 CAATTTTAAATAGGAATGAGTGG + Intergenic
1000800209 5:165716617-165716639 CTTTTGTACAAATGAATGATAGG + Intergenic
1001372785 5:171223066-171223088 CTATTTTAAAAAGAAAAAAATGG + Intronic
1001514753 5:172347546-172347568 CTTTTCTACACAGGAATGAAAGG + Intronic
1001779451 5:174355350-174355372 CTATGTTACAGAGGAAGGAGAGG + Intergenic
1001779874 5:174358753-174358775 CAGTTTTACAAAGGCATGGATGG + Intergenic
1001868471 5:175128316-175128338 GTATTTAACAAAGTTATGAAGGG + Intergenic
1002049369 5:176561371-176561393 GTATTTCTGAAAGGAATGAATGG - Intronic
1002833469 6:845346-845368 TGATTTTACAAAGCAATCAATGG + Intergenic
1003018686 6:2490537-2490559 CAATTTTACAAAAGAAAGACAGG + Intergenic
1003543666 6:7040223-7040245 TTATTTTACAGATGAAGGAATGG - Intergenic
1003637039 6:7841867-7841889 CTATTTTACATTGTAATAAAAGG + Intronic
1003995447 6:11536559-11536581 ATATTTGACAAAGCACTGAAGGG - Intergenic
1004391284 6:15211784-15211806 CCATTTTACAAATGAGTTAAAGG - Intergenic
1004545369 6:16593002-16593024 CCATTTTACAAAGTACTGATTGG + Intronic
1005034038 6:21539043-21539065 CTCTTTTAGAAAGGATTTAAAGG + Intergenic
1006726638 6:36203888-36203910 CCATTTTACAAAAGATGGAAAGG - Intronic
1007046444 6:38779869-38779891 ATATTTGTCAAATGAATGAATGG + Intronic
1007175293 6:39892350-39892372 CTACTTTAGAAAGGAGAGAATGG - Intronic
1007221785 6:40284439-40284461 CTACTCTACAAAGGCCTGAATGG + Intergenic
1007905374 6:45454600-45454622 CCAATTTAGAAAGGAATGAAAGG - Intronic
1008121791 6:47626270-47626292 CTATTTTATCAAGGACAGAAAGG - Exonic
1008351380 6:50495114-50495136 CTATTTTGCATATGGATGAAGGG + Intergenic
1008482840 6:52004934-52004956 CTATTTGGCAAAGGACTCAAGGG + Intronic
1010841922 6:80656789-80656811 CCATTTTCCAAAGGAATTACTGG - Intergenic
1010883243 6:81205459-81205481 CTACTTTACAAATGGGTGAATGG - Intergenic
1011887331 6:92112875-92112897 CTATTATTCAAAGGAAGAAAGGG - Intergenic
1011907410 6:92388893-92388915 CCATTTTACAGAGCAATGATTGG + Intergenic
1011946615 6:92912662-92912684 CTATTTAAGAAAGGATGGAAAGG - Intergenic
1012241840 6:96881400-96881422 CTATCCTACAAAGGAATAAAAGG + Intergenic
1012290207 6:97446065-97446087 TTATTTTTAAAAAGAATGAAAGG - Intergenic
1013659301 6:112278563-112278585 CAATTTTAAAAAGGAAAGCAAGG + Intergenic
1014665927 6:124237481-124237503 TTGTTATACAAAGGAATGATAGG + Intronic
1015348504 6:132188764-132188786 CTATTTTAAAAAGGAAAGAAAGG - Intergenic
1015730956 6:136347932-136347954 CTATTTTACTAAGAAGGGAAGGG + Intronic
1015754081 6:136590336-136590358 CTATTATACCAAGGAATGATAGG + Intronic
1016193402 6:141299445-141299467 ATAGTTTACAAAAGAATGGAGGG - Intergenic
1016234487 6:141846559-141846581 CTATCTTACAAATTGATGAATGG - Intergenic
1016420916 6:143882102-143882124 CTATTTTACAAATGAGAAAACGG - Intronic
1016735133 6:147469718-147469740 CTATTTTTGCAAGGAATTAAGGG + Intergenic
1016769832 6:147836843-147836865 ATATTTGACAAATGAGTGAATGG + Intergenic
1016928191 6:149374780-149374802 CTAGTTTACAATGAAATGCAGGG + Intronic
1017622402 6:156312853-156312875 TTCTTTTAAAAACGAATGAAGGG - Intergenic
1017932068 6:158964643-158964665 CTATTTTAAAAATGAGTAAAGGG - Intergenic
1017992120 6:159499826-159499848 CTTGTTTTCAATGGAATGAATGG + Intergenic
1018009020 6:159650866-159650888 CCTTTTTCCAAAGTAATGAAAGG + Intergenic
1018166000 6:161097454-161097476 TTATTTTTCAAAGGCAGGAAAGG - Intronic
1018845466 6:167552370-167552392 CGATTTTGCAAAGGCAAGAAAGG - Intergenic
1021184055 7:17542323-17542345 CTTTTTTAAAAAGGACTGAAAGG + Intergenic
1021405129 7:20257888-20257910 CCATTTTACAAAGAGATTAATGG + Intergenic
1021477720 7:21081485-21081507 TTAATTTAAAAATGAATGAATGG + Intergenic
1021493793 7:21249797-21249819 TTATCTTACAAAGAAATGAGGGG - Intergenic
1021511695 7:21440214-21440236 CTATTTTGCAAATGAAAAAAAGG - Intronic
1021932325 7:25593994-25594016 GCATTTTACAAGGGAATTAAAGG - Intergenic
1022377677 7:29829658-29829680 CTAATTTACAAATGAAGAAAAGG + Intronic
1022613765 7:31906804-31906826 CTATTTTACCAAAGAAGAAATGG - Intronic
1022872632 7:34495273-34495295 CTATTTCACAACTGAATGGAAGG - Intergenic
1022921850 7:35023617-35023639 GCATTTTACAAATGAAAGAATGG + Intronic
1023049257 7:36236836-36236858 CTATTTTACAAAGAGCTGACTGG - Intronic
1024420248 7:49157619-49157641 CCATTTTACAGAGCACTGAATGG - Intergenic
1025826762 7:65017089-65017111 GTATTATAGAAAGGGATGAACGG + Intergenic
1025914312 7:65853538-65853560 GTATTATAGAAAGGGATGAACGG + Intergenic
1026541540 7:71283915-71283937 CTATTTTACAGAGTGCTGAATGG - Intronic
1026714175 7:72772388-72772410 ATATATTTCAAATGAATGAATGG + Intronic
1027445126 7:78264994-78265016 TTATTTCTCAAAAGAATGAAAGG + Intronic
1027771564 7:82413499-82413521 TTATTTTCCTAAGGAATGATGGG - Intronic
1027845095 7:83362604-83362626 CTATATTATAAATGAATGCAAGG + Intergenic
1028657269 7:93222957-93222979 GTTTTTTACAAAGAAATCAAGGG + Intronic
1028803348 7:94994510-94994532 CTATTTAACAAAGAATAGAAAGG - Intronic
1030027505 7:105339076-105339098 GTATTTTACAAAGTTTTGAAAGG + Intronic
1030445121 7:109639634-109639656 CTCTTTTACAAAGAAGGGAATGG + Intergenic
1032419883 7:131769946-131769968 CTATTTTTCAAAAGAATGACAGG - Intergenic
1033711014 7:143944551-143944573 ATCTTTGACAAAGGAATAAAGGG - Intergenic
1033774867 7:144597877-144597899 CTATTTTTCAAAAAAATGTATGG + Intronic
1033794634 7:144833119-144833141 CTATTTTACAGATGAAGAAATGG + Intronic
1034793936 7:153995284-153995306 TTCTTTTAAGAAGGAATGAAGGG + Intronic
1035088254 7:156279768-156279790 CTATTTTACAAATGAGGAAATGG + Intergenic
1035427007 7:158784796-158784818 CCATTTTACAGAGGAAGAAATGG + Intronic
1035865607 8:3078148-3078170 ATATTTTATAAAAGAATCAAGGG - Intronic
1036454388 8:8894056-8894078 ATATTTACCAAATGAATGAATGG - Intergenic
1037078212 8:14748887-14748909 CTATTTTACAAATGGTTTAATGG + Intronic
1037488608 8:19374871-19374893 TTATTTTAAAAAGGAAAGCAAGG - Intronic
1037532140 8:19787766-19787788 CTATATTCAAAAGGAAAGAATGG + Intergenic
1037672666 8:21028659-21028681 CCCTTTTTCAAAGGAAAGAAGGG + Intergenic
1038409849 8:27349597-27349619 CCATTTTACAGGGGAATGAAAGG - Intronic
1038578421 8:28725581-28725603 ATGTTTTATAAATGAATGAATGG - Intronic
1038931301 8:32196685-32196707 TTACTCTACAATGGAATGAAAGG - Intronic
1039220603 8:35326371-35326393 ACATTTTAGAAAGGAAGGAAGGG + Intronic
1039511171 8:38093214-38093236 CTATATTAAAAAGAAAAGAAAGG - Intergenic
1039939141 8:42074231-42074253 CTTTTTGAAAAAGGAAGGAAAGG - Intergenic
1041303943 8:56440518-56440540 CAATTTTACAAATGAAGAAAGGG - Intronic
1042641253 8:70937674-70937696 CCATTTTACAAATGAATAAATGG + Intergenic
1042814312 8:72861813-72861835 CTATTTTACAGAGGATTCATGGG - Intronic
1043098096 8:76001255-76001277 CTATTTTATATGGGAATCAAAGG - Intergenic
1043235160 8:77855671-77855693 CCATTTAACAAAGAATTGAAGGG - Intergenic
1043240907 8:77934743-77934765 ATATTTTACAAATAAGTGAAGGG + Intergenic
1043256715 8:78147945-78147967 CTATTTTACAGAGCAGTGATTGG - Intergenic
1043553630 8:81404056-81404078 ATATATTTCAAATGAATGAAGGG - Intergenic
1043644604 8:82500977-82500999 GTATTTTAAAAATGAACGAAGGG + Intergenic
1043809259 8:84715616-84715638 CTTTTCTGCAAAGGAATGAAAGG + Intronic
1044134013 8:88561443-88561465 CTATTTCACAATGGAGTTAAGGG + Intergenic
1044160694 8:88910995-88911017 CTATTTTCCAAAAGATTAAAAGG - Intergenic
1045256389 8:100527359-100527381 CAATTTTAGAAAAGACTGAAAGG - Intronic
1045995498 8:108357786-108357808 CTTTTTTAAAAAGTAATAAATGG - Intronic
1046997036 8:120534848-120534870 TTTTTTTTTAAAGGAATGAAGGG - Intronic
1047738835 8:127790711-127790733 ATGTTTGATAAAGGAATGAATGG + Intergenic
1048464656 8:134655345-134655367 CTATTTATAAAAGAAATGAAAGG + Intronic
1048523225 8:135176847-135176869 CTAATTGACAAATGAATAAATGG - Intergenic
1048640564 8:136354194-136354216 CTACTTTGCAAATGAATTAATGG + Intergenic
1048837091 8:138530166-138530188 CTATTTTACAAATGACTAACTGG + Intergenic
1049296438 8:141842829-141842851 CCATTTTAGGAAGGAATCAATGG + Intergenic
1050161621 9:2725677-2725699 CTGTTTTCCAAAGGAATTAGAGG - Intronic
1050183807 9:2949921-2949943 GTATTTTACAAAGGTTTTAAGGG - Intergenic
1050346486 9:4693867-4693889 CTATTTTACAGAGGAGGAAATGG + Intronic
1050572486 9:6955664-6955686 CTATTTTACATAAGAAGAAAGGG - Intronic
1050579953 9:7043476-7043498 CTATTTAAAAAAGGAAAGAAAGG + Intronic
1052266285 9:26577439-26577461 AGATTTTCCAGAGGAATGAAAGG - Intergenic
1052462164 9:28779162-28779184 TTATTTTAAAAACGATTGAAAGG - Intergenic
1052633904 9:31075136-31075158 CTATTTTCAAAAGGAAACAAGGG + Intergenic
1053325497 9:37144340-37144362 GTATTTTGAAAAGGGATGAAAGG + Intronic
1053655203 9:40211970-40211992 GTATTTTACAAATGAATTAAAGG + Intergenic
1054367319 9:64358186-64358208 GTATTTTACAAATGAATTAAAGG + Intergenic
1054529396 9:66164344-66164366 GTATTTTACAAATGAATTAAAGG - Intergenic
1054674949 9:67847923-67847945 GTATTTTACAAATGAATTAAAGG + Intergenic
1054923877 9:70569050-70569072 CTCATTTACAAAGGAATTATTGG - Intronic
1055124669 9:72705390-72705412 CTGTTTTATAAATGAATAAATGG - Intronic
1055489380 9:76789311-76789333 CCATTTTACAAAAGAAGAAATGG + Intronic
1055518531 9:77057776-77057798 CTATTTTACAGATGAAGAAAAGG + Intergenic
1056884495 9:90428040-90428062 CTATTTTACAGAGCACTGATTGG + Intergenic
1057408107 9:94792001-94792023 CTTTTTATCAAAGGAATGAATGG - Intronic
1057567009 9:96173701-96173723 TTATTCCACAGAGGAATGAATGG - Intergenic
1057739044 9:97696040-97696062 CAAGTTTAGAAAGGAATAAAAGG + Intronic
1057791036 9:98125244-98125266 CCATTTTCCAGAGGAAGGAATGG - Intronic
1057992737 9:99788191-99788213 ATATTTTAAAAAGTGATGAAGGG - Intergenic
1058554937 9:106157125-106157147 CTATTTGAAACAGGAATGACTGG - Intergenic
1058682044 9:107448667-107448689 CTAATTTAGAAAGGAAGGGAAGG + Intergenic
1058922050 9:109626379-109626401 CTTTTTCACAAGGGAATGAAAGG + Intergenic
1059692260 9:116697362-116697384 CTATTTTACAGATGAGTGATGGG + Intronic
1059862162 9:118476688-118476710 ATATTTTACTAAGGAATTAAGGG - Intergenic
1060452152 9:123753142-123753164 TTGTTTTATGAAGGAATGAATGG - Intronic
1060609338 9:124948172-124948194 CTATTGCACAAAGGAAATAAAGG + Intronic
1185663312 X:1744241-1744263 CTTTTTTACAAAGTAATGACTGG - Intergenic
1186793185 X:13018714-13018736 CTATTTTAAAGATGACTGAAAGG - Intergenic
1187373077 X:18726404-18726426 TTATTATTCAAAGGAAGGAAAGG + Intronic
1187542898 X:20215650-20215672 CTATTTTAGAAATGAATCTAAGG + Intronic
1187755314 X:22518967-22518989 CTATTTTACAGAAGAAAAAATGG + Intergenic
1188127314 X:26384913-26384935 TGATTTTAAAATGGAATGAAAGG - Intergenic
1188136124 X:26497556-26497578 CTATTTTACAGAGCACTGATTGG - Intergenic
1188190948 X:27171171-27171193 CTATATTAGAAAGCAATCAAAGG + Intergenic
1188270360 X:28132018-28132040 CTTTTTTAAAAAGTAGTGAAAGG - Intergenic
1188285706 X:28323314-28323336 GTATTTTAGACGGGAATGAATGG - Intergenic
1188825383 X:34825977-34825999 TTATTTTAAAAAGGGAAGAAAGG + Intergenic
1188889480 X:35592537-35592559 CCAATTTACAAAGGATTAAAGGG + Intergenic
1189610716 X:42731385-42731407 ATATATTACAAAGGGAAGAAGGG + Intergenic
1189686560 X:43570258-43570280 CTTTTTTAGAAAGCAATGTATGG + Intergenic
1191979155 X:66906734-66906756 CCATTTTACAGATGAAAGAATGG + Intergenic
1192365559 X:70469746-70469768 ATATTTTAAAAAGAAATGGATGG - Intronic
1192688743 X:73336109-73336131 CTATTATACTAAGTAATGTAAGG + Intergenic
1193686536 X:84583157-84583179 CCATTTTACAGAGGAGAGAATGG + Intergenic
1193863979 X:86706330-86706352 CAATGTTATAAAGGACTGAAAGG + Intronic
1196197036 X:112847350-112847372 CTATTTTACAGATGAGGGAATGG - Intergenic
1196271660 X:113719334-113719356 CTCTATTACAAAGGAATGTCTGG - Intergenic
1196885590 X:120242425-120242447 CTTTTTTAAAAAGGAACTAAAGG - Intergenic
1197106574 X:122723724-122723746 CTATTTTACAAACAAAAAAAGGG - Intergenic
1197154247 X:123252893-123252915 CTATGAGAAAAAGGAATGAAGGG + Intronic
1197637731 X:128934022-128934044 CTATTTCATCAATGAATGAATGG + Intergenic
1197981484 X:132221883-132221905 CAACTTTACAAATGAAGGAATGG - Intergenic
1198044385 X:132886244-132886266 TTATTTTACAAAAGACTAAATGG + Intronic
1198131145 X:133696409-133696431 CAAGTTTAGAAAGGAATGACAGG - Intronic
1198324232 X:135551612-135551634 TCATGGTACAAAGGAATGAAGGG + Intronic
1198498759 X:137221383-137221405 CTACTTTACAAAGGAACTCATGG - Intergenic
1200355520 X:155546097-155546119 TCATTTTACAAAGGAAGAAATGG - Intronic
1200514805 Y:4131309-4131331 CTATTTTACAGAGGGCTGATTGG + Intergenic
1201788565 Y:17811524-17811546 CAATTTTACAAAAGACTAAATGG - Intergenic
1201812988 Y:18094464-18094486 CAATTTTACAAAAGACTAAATGG + Intergenic