ID: 900458564

View in Genome Browser
Species Human (GRCh38)
Location 1:2789412-2789434
Sequence TGTTTCCTCCTATTTTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 363}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900458564_900458567 9 Left 900458564 1:2789412-2789434 CCTTTGTAAAATAGGAGGAAACA 0: 1
1: 0
2: 1
3: 27
4: 363
Right 900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 43
900458564_900458565 -2 Left 900458564 1:2789412-2789434 CCTTTGTAAAATAGGAGGAAACA 0: 1
1: 0
2: 1
3: 27
4: 363
Right 900458565 1:2789433-2789455 CACATCCGTCGCTACCTCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 23
900458564_900458569 18 Left 900458564 1:2789412-2789434 CCTTTGTAAAATAGGAGGAAACA 0: 1
1: 0
2: 1
3: 27
4: 363
Right 900458569 1:2789453-2789475 AGGAGACCCGCAGGAAGCAGCGG 0: 1
1: 0
2: 0
3: 30
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900458564 Original CRISPR TGTTTCCTCCTATTTTACAA AGG (reversed) Intronic
900458564 1:2789412-2789434 TGTTTCCTCCTATTTTACAAAGG - Intronic
900698233 1:4026400-4026422 TTTTTACTCCTTTTTTAAAAAGG - Intergenic
902503474 1:16925346-16925368 TGTTTTCTCCTCTGTTACATGGG - Intronic
903423167 1:23233278-23233300 TGTTTCCTCATCTTTTAAAAGGG - Intergenic
903723274 1:25421815-25421837 AGTTTCCTCATTTTCTACAATGG + Intronic
904100887 1:28026102-28026124 TGATTCCTCTTGTTTTACAAGGG + Intronic
904541208 1:31234581-31234603 TGACTCTTCCTCTTTTACAAAGG + Intronic
904825914 1:33273598-33273620 TGTTTCACCCCATTTTACAGAGG + Intronic
907151699 1:52294806-52294828 TGTATCTTCCTATTTTATACAGG + Intronic
907656356 1:56346024-56346046 TGTTTCTTCCTGTTTTAAACTGG - Intergenic
908169479 1:61490485-61490507 TGTATATTCCTATTTTACACAGG - Intergenic
908225870 1:62055514-62055536 TTTTTCCTCCCATTTTACAGAGG - Intronic
908521894 1:64952112-64952134 TGTTTCCTGCTATTTTGGCAGGG - Intronic
908641189 1:66225433-66225455 TTTTTCCACATATTTTATAATGG + Intronic
909028786 1:70514714-70514736 TTATTACTCTTATTTTACAAAGG - Intergenic
910093618 1:83494718-83494740 TCTTTGGACCTATTTTACAAGGG + Intergenic
910283862 1:85531322-85531344 TGTTTCCTCATAATGTAAAAAGG + Intronic
911126074 1:94342185-94342207 TCATTACTCCCATTTTACAAAGG + Intergenic
911762492 1:101632202-101632224 TGTTTGCTCCTATTTGACATAGG - Intergenic
912051901 1:105540738-105540760 TTTTTTTTCCTATTTTACTATGG - Intergenic
912092444 1:106096922-106096944 TGTTTCCTCTAAATTTAAAATGG - Intergenic
912144209 1:106772528-106772550 AGTTTTCTCCTCTTTTTCAAGGG + Intergenic
912786166 1:112605855-112605877 TGTTTCCTCCTTGGTTTCAAAGG - Intronic
913275290 1:117131666-117131688 TGTTTCCTCCTTTGTTCCAAAGG + Intergenic
913589316 1:120308039-120308061 TGCTTCCTACTATCTTGCAAAGG + Intergenic
913618870 1:120590327-120590349 TGCTTCCTACTATCTTGCAAAGG - Intergenic
914206157 1:145531663-145531685 TGTTTCCTCATAATGTAAAAAGG - Intergenic
914571338 1:148919906-148919928 TGCTTCCTACTATCTTGCAAAGG + Intronic
914601493 1:149210358-149210380 TGCTTCCTACTATCTTGCAAAGG - Intergenic
915710554 1:157894119-157894141 TGTCTCCCCCTATTATTCAAAGG + Intronic
915775745 1:158484000-158484022 AATTTCCTCCTTTTTCACAAGGG - Intergenic
916537653 1:165718851-165718873 TGTTCCCTTATAATTTACAAAGG + Intergenic
917699004 1:177561275-177561297 TGTTTCCTCCTTGGTTTCAAAGG + Intergenic
918640030 1:186828631-186828653 TACTTCCTCCTTTTTTCCAAAGG - Intergenic
920221269 1:204403329-204403351 TGTATCATAGTATTTTACAATGG - Intergenic
920310042 1:205043488-205043510 TGTTCCCTCCCAAGTTACAAGGG - Intronic
920749102 1:208657380-208657402 TGTTTCTTCCTATTTCTCTAGGG - Intergenic
921169350 1:212532707-212532729 TCCTTCCTCCTATTCTAAAAAGG + Intergenic
921297513 1:213718599-213718621 TGTTTTCTCCATTTTTCCAAAGG + Intergenic
922193091 1:223337037-223337059 TGTTTTCTCCTACTGTACACTGG + Intronic
923889093 1:238191457-238191479 TGTTTACTGCTATTTTTCAGTGG + Intergenic
1062898449 10:1122900-1122922 TGTTTAATCCGATTTTACCACGG + Intronic
1063018155 10:2099022-2099044 TGTTTGCTCATATTTTATATAGG + Intergenic
1063482729 10:6390605-6390627 TGTTTCCTAATATTTTAGAGTGG + Intergenic
1064130671 10:12706875-12706897 TGTTTCCTCCTATGGACCAAGGG - Intronic
1065116241 10:22485897-22485919 TGTATTCTCCTATATTAAAAAGG - Intergenic
1067001039 10:42613858-42613880 TGTTTCCTTTTATTTGAGAATGG - Intronic
1067158635 10:43803638-43803660 TGTTTGCTCATATTTGAAAAAGG - Intergenic
1067162923 10:43842471-43842493 TTTTTCCTCTTGTATTACAATGG - Intergenic
1067231660 10:44416495-44416517 TCTTCACTCCTATTTTCCAAAGG - Intergenic
1068082401 10:52336059-52336081 TGTTGCTTCCTATTTTGGAAGGG - Intergenic
1068910147 10:62371677-62371699 TGTTTCCTCCTATGTAGAAAGGG + Intergenic
1069094765 10:64245508-64245530 TTTTTCCTCCTAGTTTGCAGAGG + Intergenic
1069638354 10:69939300-69939322 TGGATCTTCCTATTTTTCAAAGG + Intronic
1070448176 10:76529187-76529209 TGTTTCCTCCTCTTTAAAATAGG + Intronic
1070465487 10:76718807-76718829 TGCTTCCTCTTATTTTGGAATGG + Intergenic
1070907510 10:80086331-80086353 TGTTTCCTCCTCCTTCAGAAGGG - Intronic
1071110014 10:82144790-82144812 TGTTTCCTCCTGTATAAAAAGGG + Intronic
1071222748 10:83489056-83489078 AATTTTCTCTTATTTTACAATGG + Intergenic
1072038721 10:91587957-91587979 TTTTTACTCCTGTTTTACAAAGG - Intergenic
1072161607 10:92771950-92771972 TGTTTCCTCCTATATTAATCAGG + Intergenic
1073700655 10:105923186-105923208 TTTTTTTTACTATTTTACAACGG + Intergenic
1074244385 10:111673705-111673727 TGATTCCTTCTGTTTTAGAAGGG - Intergenic
1074347378 10:112700293-112700315 TTTTTCCTGCTATGTCACAAGGG + Intronic
1074473788 10:113751265-113751287 TGTTTCCTCATCTGGTACAAAGG + Intergenic
1074521223 10:114225985-114226007 TGATTCCTCCTACTTTAAGATGG - Intronic
1075308441 10:121390000-121390022 TGTTTGCTCCTATTGTGGAATGG - Intergenic
1076240608 10:128902717-128902739 TGTTTCTACCTATTCTACAGAGG - Intergenic
1077465792 11:2733087-2733109 TGATGCCTCCTATTTTACAGAGG - Intronic
1077718321 11:4603003-4603025 TGTATCCTCCTATATGAGAAAGG - Intronic
1078201386 11:9187193-9187215 TGTTTCCTCCCATCATACAGAGG + Intronic
1078462814 11:11528037-11528059 TGATTACCCCCATTTTACAAAGG + Intronic
1078836223 11:15032844-15032866 AGTTTCCTCATCTTTAACAAAGG - Intronic
1079633019 11:22700807-22700829 TTTTTCTTCCTAATTTTCAATGG - Intronic
1081076446 11:38679866-38679888 TGTTGCCTCTGATTTTAAAATGG - Intergenic
1081139652 11:39483115-39483137 TATTTCCTCATCTTTTAAAAGGG - Intergenic
1082117373 11:48341885-48341907 GGGTTTCTCCTATTTTAAAAGGG + Intergenic
1084836597 11:71806579-71806601 TGTTGCTTGCTTTTTTACAATGG - Intergenic
1086029577 11:82337568-82337590 TGTTTCCAACTATGTTACCATGG - Intergenic
1087500537 11:98946695-98946717 AGCTTCCTTATATTTTACAATGG - Intergenic
1087649083 11:100843693-100843715 TTTTTCCTGCTATTGTAAAAGGG - Intronic
1088096604 11:106107945-106107967 TGTTTACTCCTATTTCCCCATGG + Intergenic
1089876216 11:121724135-121724157 TTATTACTCCTGTTTTACAAAGG - Intergenic
1090598080 11:128341112-128341134 TTTTTCCCCCTATTTTACTGAGG - Intergenic
1092402639 12:8189526-8189548 TGTTGCTTGCTTTTTTACAATGG + Intergenic
1093222764 12:16443918-16443940 TGGATCCTCCTATCTTAAAAGGG - Intronic
1093293703 12:17361297-17361319 TGTTTCACCCAATTTTACATTGG + Intergenic
1093387658 12:18578308-18578330 TTTTTCCTCCTATATTCCAAAGG + Intronic
1095119453 12:38399118-38399140 ATTTTCCTCTTATTTTTCAAAGG + Intergenic
1095649900 12:44595272-44595294 TTTTTCTTCATATTTTAAAAGGG - Intronic
1096325367 12:50656057-50656079 TGTTTCATCCTATTAGAGAAGGG + Intronic
1097395595 12:59070178-59070200 TGTTCACTCACATTTTACAAAGG + Intergenic
1098255686 12:68612648-68612670 TTTTTTCTCCTATTTGACTAAGG - Intronic
1100180605 12:92081514-92081536 AGTTTCCTCATTTTTAACAATGG + Intronic
1100959699 12:99948700-99948722 TGTTTTCTCCTACATTGCAAAGG - Intronic
1101735161 12:107457970-107457992 TTATTATTCCTATTTTACAAAGG - Intronic
1103057486 12:117833164-117833186 TATCTCCTCCCTTTTTACAAGGG + Intronic
1104171151 12:126282285-126282307 TCTTTCCTCCTTTTTTTCTAAGG + Intergenic
1106388360 13:29310204-29310226 TGTTGTCACCTATTTTACACAGG + Intronic
1106540462 13:30685647-30685669 TGTTTGCTCTTATTGTACAGTGG + Intergenic
1106625440 13:31416473-31416495 TGTTTCCTCCCATTGTGCGATGG + Intergenic
1107110474 13:36692172-36692194 TGTTTTCTCCTATTCTTCCAAGG + Intronic
1107359182 13:39601389-39601411 TGTTTCCTGTTGTTTTACCAGGG - Exonic
1107461636 13:40609322-40609344 TTCTTCCTTCTGTTTTACAAAGG + Intronic
1107894325 13:44945465-44945487 TATTTCCTCCTCTTTTTTAAGGG - Intronic
1108374600 13:49802250-49802272 TTTTTACTCCTATTTTATAGAGG + Intergenic
1108558196 13:51617086-51617108 TGTTTATTCCAATTTTATAAAGG + Intronic
1108769764 13:53685272-53685294 TTTTTCCTTCCAGTTTACAAGGG - Intergenic
1109498589 13:63209023-63209045 TCTTTCCTCCTCTTTTCCAAAGG - Intergenic
1109617881 13:64860789-64860811 TTTTTCCTGCTATTTTTAAAAGG + Intergenic
1109629366 13:65024553-65024575 TCTTTCCTTCTGTTTTACTAGGG + Intergenic
1110718534 13:78735174-78735196 TCTTTTCTCTTATTTTTCAACGG - Intergenic
1111404800 13:87789969-87789991 TATTCCCTCATATTTTAAAAAGG - Intergenic
1113041940 13:106113682-106113704 TCTTCCCTACTATTTGACAAAGG + Intergenic
1114304787 14:21412642-21412664 TTTTTCCTCATATTTTAAATGGG - Intronic
1114748643 14:25178890-25178912 TGTTTTCTCTTATTTTTCATTGG - Intergenic
1117292822 14:54350062-54350084 TGCTTCTTTCTATTTTAAAAGGG - Intergenic
1117768887 14:59112038-59112060 TTTTTGCAGCTATTTTACAAGGG - Intergenic
1118133737 14:62998233-62998255 TGTTTCATCCAATTTATCAATGG + Intronic
1118291699 14:64531037-64531059 TGTTTTCTCCTATTTGAGGAAGG + Intronic
1119242891 14:73076787-73076809 TGTTTCCTCCTACCTTCCTAAGG + Intronic
1121017730 14:90558557-90558579 TGTTTGTTCCTATTTAAAAATGG - Intronic
1125349066 15:38748684-38748706 TGTTTCCTACAATTTTACCTTGG + Intergenic
1125869430 15:43085404-43085426 TGTTTCTTCCTGTTCTCCAACGG - Intronic
1126162004 15:45622048-45622070 TTTTTCATCATATTTGACAAGGG - Intronic
1127066527 15:55245404-55245426 TGTTTCCTTCTACTTTTCAAAGG - Intronic
1128073242 15:64810328-64810350 TGTTTACTCCCATTCTGCAAAGG - Intergenic
1128813394 15:70587772-70587794 TATTTCCTCCTCTTTAAAAACGG + Intergenic
1130062419 15:80579407-80579429 GGTTTCTCCCTATTTTAAAAGGG + Intronic
1130436266 15:83902882-83902904 TGTTTTCTCCTCTTTTAAATAGG - Intronic
1131633701 15:94207293-94207315 TGTACCATCGTATTTTACAATGG + Intergenic
1131657759 15:94479287-94479309 TGTTATCTCCTATTTCAGAATGG - Exonic
1133142399 16:3756565-3756587 TGTTGCCTCCTATTATAAGATGG - Intronic
1133179542 16:4042916-4042938 TTTTTAGTCCTGTTTTACAAAGG - Intronic
1133641155 16:7718580-7718602 TATTTCCTTCTATTTTACTAAGG - Intergenic
1133642954 16:7735300-7735322 TGTTTCTTCCTATGATAAAATGG + Intergenic
1133999511 16:10771723-10771745 TGTTGCCTCCCATCTTACAAAGG + Exonic
1134355128 16:13475290-13475312 TGTTTCCTCATTTTTGACATGGG - Intergenic
1134809463 16:17154950-17154972 TGTCACCTCCTCTTTTACCAGGG + Intronic
1135740039 16:24967415-24967437 TGTTTCCTGCTTTATCACAAGGG - Intronic
1135940092 16:26814923-26814945 TGTTTTCTCCAATTTACCAAGGG + Intergenic
1137410001 16:48220318-48220340 AGTTTCCTCCTTTGTGACAATGG + Intronic
1138034536 16:53591014-53591036 TGTTTCATACTATTTTCTAATGG + Intergenic
1138911743 16:61409093-61409115 TGGTTCCTTTTATTTTAGAAAGG + Intergenic
1139256394 16:65546990-65547012 TGATTCCACCTATTTCACAGGGG + Intergenic
1144095322 17:11895037-11895059 TGTTTCCTCCTATGTTAAATGGG - Intronic
1144243745 17:13341185-13341207 TGTCTCTTCCTTTTTTATAAGGG + Intergenic
1145901615 17:28493866-28493888 TGTTACCTCCTGTTCTGCAATGG - Intronic
1146425571 17:32734533-32734555 TCTTTCTTGTTATTTTACAAAGG + Intronic
1146501618 17:33369647-33369669 TGTTTCCTCCTCTGTAACATGGG - Intronic
1146745551 17:35325613-35325635 TGTTTGCAGCTATTGTACAAGGG + Intergenic
1146798621 17:35800828-35800850 ATTTTCCTCCCATTTTATAATGG - Intronic
1148816264 17:50330132-50330154 TGTCTCCTCCTATTGTGGAAGGG - Intergenic
1149596871 17:57869373-57869395 TGTTTCCTCCTCTGTAAAAATGG + Intronic
1151140027 17:71982778-71982800 TATTTCCTTCTATTTAAAAATGG + Intergenic
1152666177 17:81570930-81570952 TCTTTCCTCTTCTTTTATAAAGG - Intronic
1155293694 18:24366150-24366172 TGTTTACTGCTTTATTACAAAGG + Intronic
1155528128 18:26738350-26738372 TGTTTCATCATTTTTTATAATGG + Intergenic
1156277670 18:35599148-35599170 TGTTTTCTCCTATTATAAACAGG + Intronic
1157099380 18:44715571-44715593 TGTTTGCTCATATTTAATAAGGG + Intronic
1157428426 18:47603374-47603396 TGTTTCCTCCTCTGTTAAATGGG + Intergenic
1158974955 18:62703024-62703046 TGTTTCCTCCCATATGACAGTGG + Intergenic
1159397515 18:67881773-67881795 TGTTCCCACATATTTTAGAAGGG + Intergenic
1159571901 18:70124014-70124036 TTGTTCATGCTATTTTACAAGGG - Intronic
1159589264 18:70314886-70314908 TGTCTATTCCTATTTTACAATGG + Intronic
1159845793 18:73458386-73458408 TGTTTCCTCCTTTTTAAAATGGG + Intergenic
1160043480 18:75366244-75366266 TGTCTCCTCTTATCTTACACTGG - Intergenic
1163944876 19:20526165-20526187 TGTTTTCACCTATTTTCTAAGGG + Intergenic
1164775439 19:30849900-30849922 TCTTTATTCCTATTTTAAAAGGG + Intergenic
1164786123 19:30932540-30932562 TGATTCCACCTTTCTTACAAAGG - Intergenic
1165843133 19:38801453-38801475 TGTTTCCTCATCTGTTACAGAGG + Intergenic
1167625775 19:50588113-50588135 TGTTTCCTCATATGTAAAAACGG + Intergenic
925383098 2:3441758-3441780 TCTTTCCTTCTAGTTTTCAAAGG + Intronic
927723237 2:25400832-25400854 TGTTTCCAACTGTTATACAAGGG - Intronic
928630956 2:33191605-33191627 TGTATCCTACTATCCTACAAAGG + Intronic
929206932 2:39306545-39306567 TGTTTCTTCAGATTTAACAATGG + Intronic
929914502 2:46122996-46123018 TCTTTCCTCAGATTTTACCAGGG - Intronic
930442130 2:51422191-51422213 TGTTACCTCCTATATTCCCAAGG + Intergenic
930573973 2:53123412-53123434 TGTTTGCACCTATTGTAAAAGGG + Intergenic
931292762 2:60890325-60890347 TGATTATTCCTATTTTACAGAGG + Intronic
931431837 2:62214698-62214720 TGTATCATCCCATTTTACAAAGG + Intronic
931877771 2:66532469-66532491 TGTTTACCCCTATTTTAAGAAGG - Intronic
932748336 2:74353972-74353994 TGTCTCTTCCTATGATACAAAGG + Intronic
932942357 2:76182313-76182335 TATTTTCACATATTTTACAAAGG + Intergenic
933310515 2:80655359-80655381 TGTTTCCTGGTATTTTACTAAGG - Intergenic
933525965 2:83439350-83439372 TGTTTTATTATATTTTACAATGG - Intergenic
935782473 2:106520259-106520281 TGTTTCCTCATGTTTTCAAATGG - Intergenic
938212867 2:129483269-129483291 TCTTTCCTCCTCTTTTCCACTGG + Intergenic
939216865 2:139249982-139250004 TATTTCCTACTATCTTTCAATGG + Intergenic
939438754 2:142214392-142214414 GGTTTCCTCCTCTTTTCCACTGG + Intergenic
939566687 2:143793886-143793908 TGTTTCCTCGTTTGTTGCAAAGG + Intergenic
940463040 2:153991892-153991914 TGATCACTCCTATTTTACTAAGG + Intronic
941339189 2:164285291-164285313 TATTGCCTTCTATTTTAAAAAGG + Intergenic
943763501 2:191635351-191635373 TCATTCCTCATATTATACAATGG - Intergenic
943842528 2:192600443-192600465 TATTTCTTCCAATTTCACAAGGG + Intergenic
944383527 2:199139435-199139457 TGGTCCCTCCTACTCTACAAAGG - Intergenic
944684040 2:202102452-202102474 TGATTACTCCTGTTTTACAGAGG + Intronic
945160738 2:206887747-206887769 TGTTGCCTCCTAATTTGAAAAGG + Intergenic
946892110 2:224287753-224287775 TGTGTCCTCATATATAACAAGGG + Intergenic
947262580 2:228240486-228240508 GGTTTCCTCCTGTTTTTGAAAGG + Intergenic
948105645 2:235411680-235411702 TTCTTCTTCCTATTTTACAGTGG + Intergenic
1169682961 20:8237563-8237585 TATTTCATTGTATTTTACAATGG + Intronic
1169844162 20:9971611-9971633 TGTGTCCTCCTATGATAAAAGGG - Intergenic
1170142927 20:13143028-13143050 AAAGTCCTCCTATTTTACAAAGG - Intronic
1171938805 20:31303959-31303981 TGTTTGCTCCTATGTTTCAGAGG - Intronic
1173386571 20:42593850-42593872 TATTTTCTCCTACTTAACAAAGG - Intronic
1175270208 20:57728548-57728570 TGTTTCCACCCATTTTACAGAGG - Intergenic
1175375227 20:58519490-58519512 AGCTTCATCCTATTTTACAGAGG - Intergenic
1175864310 20:62166578-62166600 TGTTTCCCCCAGGTTTACAAAGG - Intronic
1178040514 21:28635691-28635713 TGTTTCCTCATATTTAAAATAGG - Intergenic
1179127545 21:38603738-38603760 GCTTTCCTCCTATTTTTCTAAGG - Intronic
1179307934 21:40171674-40171696 TGTTTGCTTGTGTTTTACAAAGG + Intronic
1180619724 22:17152953-17152975 TGCTTCCTCCTGTTTTTCCAGGG - Intronic
1181337274 22:22147151-22147173 TTTTGCCTTCTATTTTAGAAGGG - Intergenic
1182850337 22:33468555-33468577 TGTGTCCTCCTTTTTGCCAAAGG - Intronic
1183996911 22:41640925-41640947 TTTTTGCTCCCATTTTACTAAGG - Intronic
1184001751 22:41679682-41679704 TTTTTTTTCCTTTTTTACAAAGG + Intronic
949101299 3:148973-148995 TATTACCTCCACTTTTACAAAGG + Intergenic
949473534 3:4420772-4420794 TGTTTCCTCATCTTTTAAATAGG - Intronic
951510946 3:23501437-23501459 TGTTTCCTCCTCTGTGACAGGGG - Intronic
951865683 3:27304746-27304768 AGCTTCTTCATATTTTACAAGGG - Exonic
951880507 3:27477072-27477094 AGTTTCCTTCTATTTTTAAAAGG - Intronic
954521812 3:51234524-51234546 TGTTAGCTCCTTTTTTAAAAAGG + Intronic
956502784 3:69904833-69904855 TCTTTATTCCCATTTTACAAAGG - Intronic
956945684 3:74219858-74219880 TATTTCCTCCTATTTTCTGATGG + Intergenic
957375313 3:79348806-79348828 TGCTTCTTCCTATTTCAAAAGGG + Intronic
957599556 3:82316545-82316567 TTTTTTCTAGTATTTTACAATGG - Intergenic
957961909 3:87267279-87267301 TTTTTCCCCATAATTTACAATGG + Intronic
958186896 3:90133330-90133352 TGTTTCCTCTTCTTTTTCAAAGG + Intergenic
958688506 3:97429862-97429884 AGTTTCTTCCTATTTGATAAGGG + Intronic
959364077 3:105434390-105434412 TATTTCATCCTAATTTACCATGG - Intronic
959368587 3:105494317-105494339 TATTTCCTGGTATTTTATAAGGG + Intronic
959963650 3:112330819-112330841 TGTTTTCTCCTAACTTACTAAGG - Intergenic
963200020 3:142576927-142576949 TGTTTCCTCTTAATTGACTATGG - Intronic
963366868 3:144346189-144346211 TATTTCCTTCAATTTTAGAATGG - Intergenic
963486750 3:145944100-145944122 TGTTTCCACCTATATCACTATGG + Intergenic
964847276 3:161057658-161057680 TGTTTCCTCCGATTTTTCAAGGG - Intronic
965225865 3:165988929-165988951 AATTTCCTCTTATTCTACAATGG + Intergenic
966723365 3:183086471-183086493 TCTTTCCACCTATTTCCCAAAGG + Intronic
966741091 3:183234657-183234679 CATTTTCTCCTATTTTATAAAGG - Intronic
966960397 3:184931017-184931039 TGATGCCTGCTATTTTACAGAGG + Intronic
967972573 3:195010431-195010453 AGTTTCCTCCTATTTCAAACAGG - Intergenic
969189719 4:5507362-5507384 AGTTTCCTCCTTTGTTAAAAGGG - Intergenic
969200461 4:5600393-5600415 CGTTTCCCCCTATTTTAAAGAGG + Intronic
969778006 4:9374100-9374122 TGTTGCTTGCTTTTTTACAATGG - Intergenic
970037079 4:11748963-11748985 TTTTTCCTCCCATCTTACAGAGG + Intergenic
972030593 4:34452315-34452337 TGTCTCCTGCTAATTCACAAAGG - Intergenic
972198333 4:36681311-36681333 TTTTTCCTCCTCTTTTATAAAGG + Intergenic
973142342 4:46783919-46783941 GGTTTCCTCCTCTTCTACTAAGG + Intronic
974817817 4:67028530-67028552 TGATTCCTCTTATTTCAAAACGG - Intergenic
975045481 4:69798186-69798208 TTTTTCCCCCTATTTTCAAATGG - Intergenic
975444592 4:74447503-74447525 TGTTATCTCATATTTTAAAAAGG + Intronic
977144968 4:93427946-93427968 TATTTTCTCCTAGTTTAGAAGGG + Intronic
978633378 4:110774061-110774083 TGTGTCCTCCAATTTAACACAGG - Intergenic
979166725 4:117542346-117542368 TGTGTCCTCCAATATTGCAAAGG - Intergenic
979672871 4:123379542-123379564 TGTTTCCTCCTGTCTTACTCAGG + Intergenic
979821196 4:125174301-125174323 TGTTTTCTCCCTTTTTCCAATGG + Intergenic
980391482 4:132153340-132153362 TTTTTCCAGCTATTTTAAAAGGG + Intergenic
981777344 4:148385223-148385245 AGTTTCTTCCTATTATATAATGG - Intronic
982724404 4:158890353-158890375 TTTTTCCTACTATTATCCAAGGG - Intronic
982903685 4:161041314-161041336 TGTTTTCACTTATTTTACAGAGG + Intergenic
984542837 4:181061606-181061628 TGTATGCTCCCATGTTACAATGG - Intergenic
986229197 5:5846086-5846108 TTTTTTCGCCTAGTTTACAAGGG + Intergenic
988066755 5:26235071-26235093 TGTTTGGACCTATTATACAAAGG - Intergenic
988878691 5:35476009-35476031 TTTTTCCCCCAATTTTAAAAGGG + Intergenic
988918794 5:35921876-35921898 TGTTTCCTCCTCTTTTAACTGGG + Intronic
989470533 5:41812457-41812479 TGTTTCTTCGTATTTTATCAGGG + Intronic
989961672 5:50423303-50423325 TCTCTTCTCCTCTTTTACAATGG - Intronic
990393293 5:55350329-55350351 TGTTTCTTGCTATTTGAAAAGGG + Intronic
990645505 5:57839150-57839172 TATTGCCTTCTATTTTATAATGG - Intergenic
991385155 5:66079567-66079589 TGTTTCCTTTTACTTTACCAAGG - Intronic
992044596 5:72873153-72873175 TGATGCCTCTAATTTTACAATGG - Intronic
992155784 5:73953825-73953847 CGTCTCCTCCTTTTTTATAAGGG - Intergenic
993637385 5:90361344-90361366 TGTTTCCTCCTATTTGCAAGGGG - Intergenic
993653141 5:90546049-90546071 ATTTTCTTCCTATTTTAAAACGG - Intronic
994381365 5:99075770-99075792 TGTTTCCTCCTTTTTTTGTAAGG + Intergenic
994541749 5:101108354-101108376 TGTTTCCTCCTCCATTTCAAAGG - Intergenic
994930344 5:106174829-106174851 TGCTTCATCCTTTTTTAAAATGG + Intergenic
995123908 5:108561274-108561296 TGTTTCCTCATATGCTACAGTGG + Intergenic
995562785 5:113401331-113401353 CCTTTACTCCTTTTTTACAATGG - Intronic
996397332 5:123026485-123026507 TTCTCCGTCCTATTTTACAATGG + Intronic
996494630 5:124139600-124139622 TGTATTTTCCTATTTTAGAAAGG - Intergenic
997786767 5:136720697-136720719 TCTTTCCTCCTAGTTTCCATAGG - Intergenic
997838228 5:137214213-137214235 TTTTTATTTCTATTTTACAAAGG + Intronic
998993362 5:147843625-147843647 TGTTCCCTCTCACTTTACAAGGG - Intergenic
999969182 5:156841998-156842020 AGTTTCCTCCTATTTAAAACAGG - Intergenic
1000213547 5:159132687-159132709 TTTTTCCTCCTTTTTTTAAAAGG - Intergenic
1000721694 5:164716085-164716107 TGTTTCCTTCTACTTTCCAGAGG + Intergenic
1000888869 5:166780686-166780708 TGTTTCCAAACATTTTACAAGGG - Intergenic
1001594229 5:172887482-172887504 TGTTTCCTCCTTTGTAAAAATGG - Intronic
1002683996 5:180992798-180992820 TGTTTCCTCCTATAGGACAGTGG + Exonic
1004956457 6:20732986-20733008 TGTTTCCATCTGCTTTACAAGGG - Intronic
1005317124 6:24613978-24614000 TATTTCCTCCTATTATCCACAGG - Intronic
1007221509 6:40282571-40282593 TATACCCTCCTATATTACAAGGG + Intergenic
1007355208 6:41310113-41310135 TTTTTCCTTCTGTTTTACAGAGG - Intergenic
1007422585 6:41728617-41728639 TGTTTTCTCCTGTTTGCCAAGGG - Intronic
1007913976 6:45543401-45543423 TGTTCCTTGCTATTTTAAAAAGG + Intronic
1007986284 6:46210353-46210375 TGTTCCCTCCTATTATTCGAAGG - Intergenic
1008103596 6:47419190-47419212 TTTTTCCTTCTATGTTAGAAGGG + Intergenic
1008349232 6:50470067-50470089 TGCTGCCTCCCATTTTACAGAGG + Intergenic
1008368307 6:50707297-50707319 CGTTTCCTCATCTTTTGCAAAGG + Intergenic
1009195863 6:60683657-60683679 TGTTTCCTCATATTTAAAATGGG + Intergenic
1009474143 6:64066767-64066789 TGTTTCCCCATATGTTAAAATGG + Intronic
1009548693 6:65057727-65057749 TTTTTTTTCCTATTTTCCAAAGG - Exonic
1011389106 6:86832209-86832231 TGTTTCCTCATTTTTAAAAATGG - Intergenic
1012419910 6:99053487-99053509 TGATTCCACATATTTTACACAGG + Intergenic
1013905947 6:115219952-115219974 TGTTTCCTCACATTTGAAAATGG - Intergenic
1014483748 6:121972951-121972973 TGTTTCCTCATATTTGAAAGAGG + Intergenic
1015039518 6:128699923-128699945 TGTTCTCTCATATTTTAAAAAGG + Intergenic
1015310896 6:131766034-131766056 TTTTTATTCCCATTTTACAAAGG - Intergenic
1015747043 6:136521139-136521161 TGTGTCTTCCAATTTTTCAAGGG + Intronic
1016299323 6:142612452-142612474 TGTCTCTTCCTCTTTTAAAAAGG + Intergenic
1016622836 6:146132606-146132628 AATTTACTCCTATTTTAGAATGG + Intronic
1017185261 6:151594308-151594330 TGTTTCCTCATATTTAAGATGGG + Intronic
1017776744 6:157686804-157686826 TTTTTCCTCCTAATTTTCTAGGG + Intergenic
1018677868 6:166238057-166238079 TTTTTCATTCTATTTTAAAAAGG - Intergenic
1020607544 7:10357541-10357563 TGTCTCCTGCTAAATTACAAAGG + Intergenic
1020829286 7:13073485-13073507 TTTTTGCTCTTATTTTAAAAAGG + Intergenic
1021053352 7:16017297-16017319 TGTTTCCTACTATTTTATCATGG - Intergenic
1021812031 7:24411996-24412018 TGTTGCCTCCTATTTTTACAGGG - Intergenic
1022755253 7:33280771-33280793 TGTTTTTTCATATTTTAAAAAGG - Intronic
1023034349 7:36117590-36117612 TGTTTCCTCCTCTGTAACCAGGG - Intergenic
1023297731 7:38733614-38733636 TGTTTCCTCCTGTTTTACCCTGG + Intronic
1024469328 7:49750787-49750809 TGTTTCCTGTTCTCTTACAATGG - Intergenic
1025029040 7:55540886-55540908 TTTTTCCTTGTATTTTAAAATGG - Intronic
1025270359 7:57506904-57506926 TGTCTCCTGCTAATTCACAAAGG + Intergenic
1026662411 7:72313832-72313854 TGTTTCCTTGTAGTTTACAGGGG - Intronic
1027461550 7:78460628-78460650 GGTTTACTCCTTATTTACAAAGG + Intronic
1027551045 7:79595732-79595754 GGTTTACTGCTATTTTAAAATGG - Intergenic
1028030649 7:85907808-85907830 TGTGTCCTCATATTTTGGAAGGG - Intergenic
1028443536 7:90892270-90892292 TCTGTCCTCCTCTTTTAAAAGGG + Intronic
1029282237 7:99443283-99443305 GGGTTCTTCCTATTTGACAAGGG + Intronic
1030120305 7:106103712-106103734 TGTTTCCTCTTATTTTAGTGTGG + Intronic
1030571208 7:111226999-111227021 TGTTTCCTCCTATTTCATCAGGG - Intronic
1033787346 7:144748996-144749018 ACTTTCCTCCTTTTTTTCAAGGG - Intronic
1033897743 7:146095428-146095450 TGTTTCCTTGGATTTTAAAAAGG - Intergenic
1035637654 8:1158856-1158878 TCTTACTTCCTATTTTCCAAAGG + Intergenic
1036060909 8:5319229-5319251 TGGATCCTCATATTTTAAAATGG + Intergenic
1036076961 8:5512908-5512930 TGTTAACTTTTATTTTACAACGG - Intergenic
1036092371 8:5681393-5681415 TGTTTGCTGTTATTTTCCAAAGG + Intergenic
1036345894 8:7962288-7962310 TGTTGCTTGCTTTTTTACAATGG + Intergenic
1036863028 8:12369293-12369315 TGTTGCTTGCTTTTTTACAATGG + Intergenic
1038954941 8:32457503-32457525 TATTTCCTTTTATATTACAAGGG - Intronic
1039236879 8:35511544-35511566 TGTTTTCTTCTATTTAACATAGG - Intronic
1039603666 8:38863595-38863617 GGTTTCCTCCTAGTTTAGGAAGG - Intergenic
1040897745 8:52386660-52386682 TCTTTCCTTTTATTTTAAAAGGG + Intronic
1041136873 8:54768384-54768406 TGTTTCCTTCTGTTTTACACTGG + Intergenic
1042850489 8:73211582-73211604 TGTCTCCTCCTCTTTTTAAAAGG - Intergenic
1043267157 8:78280417-78280439 TCTTTCATTTTATTTTACAAAGG - Intergenic
1044191895 8:89329191-89329213 TCTTTCCTCTTTTTTAACAATGG - Intergenic
1044311912 8:90703522-90703544 TTTTTCTTCCTACTTTACACAGG - Intronic
1044477850 8:92649287-92649309 TTTTTCCCCCAATTTTGCAAGGG + Intergenic
1044801360 8:95960361-95960383 TCTTTCCTCTTATTTGATAAAGG + Intergenic
1045686410 8:104717025-104717047 TGTTTGCTCCTTTTTTTCAGGGG + Intronic
1045766142 8:105672643-105672665 TGTTTCCTGCCTTATTACAATGG + Intronic
1046317268 8:112520946-112520968 TGTTTCCTTGTCTTTTAAAATGG + Intronic
1046396007 8:113640628-113640650 TGTGTCATCATATCTTACAATGG - Intergenic
1047653181 8:126946930-126946952 TGTTTCCTCATATATAAAAATGG - Intergenic
1048178180 8:132171465-132171487 TGTTTCCTCTTATATTTCAGAGG - Intronic
1051030580 9:12670471-12670493 TGTCTCCTGTTATTTTATAATGG - Intergenic
1051168965 9:14298703-14298725 TGTTTCCTCTTATTCTTTAATGG - Intronic
1051178316 9:14383546-14383568 TGTTTCCTCTTCCTTTATAAGGG + Intronic
1051713826 9:19960773-19960795 TGTTTCCTCATTTTTTACACAGG - Intergenic
1051762804 9:20486683-20486705 TGTTTCCACTTATTCTCCAAGGG + Intronic
1052387367 9:27837857-27837879 GGTTTCCTCCCGTTATACAAGGG - Intergenic
1052477466 9:28978487-28978509 AGTTTCCTCCTTTTATAAAATGG + Intergenic
1052501537 9:29298079-29298101 TTTTTCATACTATTTTACAATGG - Intergenic
1054896083 9:70312819-70312841 TGTTTACCAATATTTTACAAAGG + Intronic
1055032305 9:71783071-71783093 TCTTGCCTCCTGTTTTACATTGG - Intronic
1055364637 9:75529340-75529362 TCTTTGCTCCTTTTGTACAAAGG + Intergenic
1056661780 9:88548920-88548942 TGTGTCCTCATATATTAGAAGGG - Intronic
1059088505 9:111331208-111331230 TGTTTCCTTCTAGTTAAGAATGG - Intergenic
1060196202 9:121625112-121625134 TTTTTCCCCATATTTTACAGAGG + Intronic
1060585405 9:124782499-124782521 TGATTCTTCCCATTTTACAGAGG + Intronic
1061284104 9:129612566-129612588 TGTTTCCTCATCTTTTAAAATGG - Intronic
1203630190 Un_KI270750v1:66988-67010 TGTTTCCTCCTATGTAAAATGGG - Intergenic
1185837274 X:3356747-3356769 TATTTCCTTATATATTACAATGG - Intergenic
1185983785 X:4808018-4808040 TATTTCATTCTATATTACAATGG - Intergenic
1186247239 X:7627149-7627171 AGCTTCCTGCTATTTTAAAAAGG - Intergenic
1186603915 X:11068921-11068943 AGTCTCCTCCTTTTTTATAAAGG + Intergenic
1188352547 X:29150011-29150033 TGTTTCCTTTTATGTTAAAATGG + Intronic
1188505246 X:30875479-30875501 TTTTTTTTCCTATTTCACAAGGG + Intronic
1188804862 X:34575316-34575338 TGTTGCCTGCAATTTTCCAAAGG - Intergenic
1189156015 X:38757431-38757453 TGTTTCTTCCAGTTTTCCAAAGG - Intergenic
1193355037 X:80509758-80509780 TTTTTCCTTACATTTTACAAAGG - Intergenic
1194003485 X:88461027-88461049 TTTTTCCTCCTATTTTAACTTGG + Intergenic
1194546434 X:95240181-95240203 TCTTTCCTCCCCTTTTCCAAAGG - Intergenic
1197485026 X:127038133-127038155 TTATTCTTCCCATTTTACAAAGG + Intergenic
1197900603 X:131367704-131367726 AGATTCCTCCTAGATTACAAAGG + Intronic
1198461434 X:136866479-136866501 TGTTTCCTCCCATATCCCAAAGG + Intronic
1199550955 X:149060894-149060916 TTTTTCCTCCTATTTCACATGGG + Intergenic
1201238893 Y:11938808-11938830 TATTTCCTCATGTATTACAAGGG + Intergenic