ID: 900458567

View in Genome Browser
Species Human (GRCh38)
Location 1:2789444-2789466
Sequence CTACCTCGAAGGAGACCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900458561_900458567 18 Left 900458561 1:2789403-2789425 CCGTTCATTCCTTTGTAAAATAG 0: 1
1: 0
2: 3
3: 64
4: 585
Right 900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 43
900458559_900458567 27 Left 900458559 1:2789394-2789416 CCACTGCCTCCGTTCATTCCTTT 0: 1
1: 0
2: 7
3: 65
4: 684
Right 900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 43
900458560_900458567 21 Left 900458560 1:2789400-2789422 CCTCCGTTCATTCCTTTGTAAAA 0: 1
1: 0
2: 5
3: 67
4: 671
Right 900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 43
900458564_900458567 9 Left 900458564 1:2789412-2789434 CCTTTGTAAAATAGGAGGAAACA 0: 1
1: 0
2: 1
3: 27
4: 363
Right 900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900458567 Original CRISPR CTACCTCGAAGGAGACCCGC AGG Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
901125775 1:6927783-6927805 CTAACTCACAGGAGACCTGCAGG - Intronic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
923959371 1:239059327-239059349 CTTCCTCGAAGGTGTCCAGCAGG + Intergenic
1068544315 10:58328754-58328776 CTACCTAGAAGTAGAACTGCTGG + Intergenic
1076930980 10:133531606-133531628 CTACCTGGAAGGACATCCGGCGG + Exonic
1077108407 11:851661-851683 CTACCTCCAAGGCGCCCCTCAGG - Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1084759477 11:71260176-71260198 CTCCCTCCAAGCAGACCTGCTGG - Intergenic
1091712243 12:2750264-2750286 CCACCTCCATGGAGACCAGCAGG - Intergenic
1092063602 12:5571131-5571153 ACACCTCCAAGCAGACCCGCTGG + Intronic
1097523277 12:60696407-60696429 CTACCTCAAAGCAAATCCGCTGG + Intergenic
1113542973 13:111123236-111123258 CTACCTCCGAGGAGACCCCAGGG + Intronic
1117444058 14:55786960-55786982 CTCCCTGGAAGAAGACCCGTGGG - Intergenic
1119378243 14:74212177-74212199 CTCCCTCGAAGGAGAGCCCAAGG - Intergenic
1122784468 14:104157481-104157503 CTGCCTCCAAGGAGTCCTGCTGG + Intronic
1151961743 17:77409316-77409338 CCACCACGAAGGAGACACACCGG - Intronic
1161073414 19:2273605-2273627 CTCCCACGGAGGAGACCCCCTGG + Intronic
1161963755 19:7536361-7536383 CTTCCTTGATGGAGACCCCCTGG + Intronic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
926757009 2:16244469-16244491 CTACCATGAATGAGACCTGCTGG + Intergenic
935595489 2:104874159-104874181 CTTCCTCCCAGGAGACCCGCAGG - Intergenic
1179409803 21:41153901-41153923 CTACCTGGAAGGCTACCTGCTGG - Intergenic
1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG + Intergenic
954871375 3:53769815-53769837 CCACCTCCAAGGAGAGCCACTGG + Intronic
968410713 4:387288-387310 CTCCCTCGGAGGAGACCTGGAGG - Intergenic
972470383 4:39398093-39398115 CTACCCAGAAGGAGAACTGCTGG + Intergenic
974075640 4:57165927-57165949 CTACCTTCAAGGAGATCCTCAGG + Intergenic
996920914 5:128766563-128766585 CTATCTGGATGGAGACCAGCAGG + Intronic
997207159 5:132056730-132056752 AAACCTTGAAGGAGACCCCCAGG + Intergenic
997605189 5:135170202-135170224 CCCCCTCGAAGGAGAACTGCAGG - Intronic
1000518391 5:162269042-162269064 CAGCGTGGAAGGAGACCCGCAGG - Intergenic
1005056827 6:21737103-21737125 CTACCTCGAAGGAGAAAGGAGGG - Intergenic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1010003511 6:70971481-70971503 CTAACTCTCAGGAGACCCACAGG + Intergenic
1015939069 6:138431159-138431181 CTACCAAGGAGGAGACCAGCAGG - Exonic
1016857352 6:148684465-148684487 CTACCCAGAAGGAGACCACCAGG + Intergenic
1016950749 6:149577298-149577320 GTTCCACGAAGGAGACCCACGGG + Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG + Intergenic
1062651015 9:137577717-137577739 CTGCCTGGAAGGAGAACCTCTGG + Intronic
1187955194 X:24510852-24510874 CAACCTAGAAGGAAACCTGCAGG + Intronic
1199664668 X:150087262-150087284 CTACCTAGAAACAGACCCACAGG + Intergenic