ID: 900458567

View in Genome Browser
Species Human (GRCh38)
Location 1:2789444-2789466
Sequence CTACCTCGAAGGAGACCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900458561_900458567 18 Left 900458561 1:2789403-2789425 CCGTTCATTCCTTTGTAAAATAG 0: 1
1: 0
2: 3
3: 64
4: 585
Right 900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 43
900458564_900458567 9 Left 900458564 1:2789412-2789434 CCTTTGTAAAATAGGAGGAAACA 0: 1
1: 0
2: 1
3: 27
4: 363
Right 900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 43
900458560_900458567 21 Left 900458560 1:2789400-2789422 CCTCCGTTCATTCCTTTGTAAAA 0: 1
1: 0
2: 5
3: 67
4: 671
Right 900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 43
900458559_900458567 27 Left 900458559 1:2789394-2789416 CCACTGCCTCCGTTCATTCCTTT 0: 1
1: 0
2: 7
3: 65
4: 684
Right 900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900458567 Original CRISPR CTACCTCGAAGGAGACCCGC AGG Intronic