ID: 900461613

View in Genome Browser
Species Human (GRCh38)
Location 1:2804652-2804674
Sequence TGCCAAAGGCAGTGCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900461613_900461617 8 Left 900461613 1:2804652-2804674 CCAGGCCTGCACTGCCTTTGGCA No data
Right 900461617 1:2804683-2804705 GCCTCCGTGCAGCTTCCCCAGGG No data
900461613_900461616 7 Left 900461613 1:2804652-2804674 CCAGGCCTGCACTGCCTTTGGCA No data
Right 900461616 1:2804682-2804704 TGCCTCCGTGCAGCTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900461613 Original CRISPR TGCCAAAGGCAGTGCAGGCC TGG (reversed) Intergenic
No off target data available for this crispr