ID: 900463719

View in Genome Browser
Species Human (GRCh38)
Location 1:2813556-2813578
Sequence GCCCCACGGGAGCCCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900463719_900463723 -6 Left 900463719 1:2813556-2813578 CCCACTGTGGGCTCCCGTGGGGC No data
Right 900463723 1:2813573-2813595 TGGGGCCCAGCCTCCCTGACAGG No data
900463719_900463729 14 Left 900463719 1:2813556-2813578 CCCACTGTGGGCTCCCGTGGGGC No data
Right 900463729 1:2813593-2813615 AGGTGCCGCCCTCTGCTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900463719 Original CRISPR GCCCCACGGGAGCCCACAGT GGG (reversed) Intergenic