ID: 900464497

View in Genome Browser
Species Human (GRCh38)
Location 1:2818451-2818473
Sequence CCTGCCCTGCAGGGGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900464484_900464497 17 Left 900464484 1:2818411-2818433 CCACTATGGGAACCAGGTGCACC No data
Right 900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG No data
900464487_900464497 -4 Left 900464487 1:2818432-2818454 CCCCAGGCTCTCCCTGCTGCCTG No data
Right 900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG No data
900464488_900464497 -5 Left 900464488 1:2818433-2818455 CCCAGGCTCTCCCTGCTGCCTGC No data
Right 900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG No data
900464486_900464497 5 Left 900464486 1:2818423-2818445 CCAGGTGCACCCCAGGCTCTCCC No data
Right 900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG No data
900464483_900464497 21 Left 900464483 1:2818407-2818429 CCAACCACTATGGGAACCAGGTG No data
Right 900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG No data
900464489_900464497 -6 Left 900464489 1:2818434-2818456 CCAGGCTCTCCCTGCTGCCTGCC No data
Right 900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900464497 Original CRISPR CCTGCCCTGCAGGGGCTGCA GGG Intergenic
No off target data available for this crispr