ID: 900464556

View in Genome Browser
Species Human (GRCh38)
Location 1:2818946-2818968
Sequence GCCTAGGAATGGCGCTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900464556_900464564 21 Left 900464556 1:2818946-2818968 CCTGGACAGCGCCATTCCTAGGC No data
Right 900464564 1:2818990-2819012 CTGCCGTGTCTCTGATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900464556 Original CRISPR GCCTAGGAATGGCGCTGTCC AGG (reversed) Intergenic
No off target data available for this crispr