ID: 900467016

View in Genome Browser
Species Human (GRCh38)
Location 1:2830851-2830873
Sequence GGCGGGGGCGGGGGCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900467016_900467033 15 Left 900467016 1:2830851-2830873 CCTGCCCCGCCCCCGCCCCCGCC No data
Right 900467033 1:2830889-2830911 ATCTCCCGGAGCCCCGGCGAGGG No data
900467016_900467034 16 Left 900467016 1:2830851-2830873 CCTGCCCCGCCCCCGCCCCCGCC No data
Right 900467034 1:2830890-2830912 TCTCCCGGAGCCCCGGCGAGGGG No data
900467016_900467030 1 Left 900467016 1:2830851-2830873 CCTGCCCCGCCCCCGCCCCCGCC No data
Right 900467030 1:2830875-2830897 CCTGCTGCTGCTTCATCTCCCGG No data
900467016_900467035 17 Left 900467016 1:2830851-2830873 CCTGCCCCGCCCCCGCCCCCGCC No data
Right 900467035 1:2830891-2830913 CTCCCGGAGCCCCGGCGAGGGGG No data
900467016_900467038 21 Left 900467016 1:2830851-2830873 CCTGCCCCGCCCCCGCCCCCGCC No data
Right 900467038 1:2830895-2830917 CGGAGCCCCGGCGAGGGGGAAGG No data
900467016_900467032 14 Left 900467016 1:2830851-2830873 CCTGCCCCGCCCCCGCCCCCGCC No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467016_900467031 9 Left 900467016 1:2830851-2830873 CCTGCCCCGCCCCCGCCCCCGCC No data
Right 900467031 1:2830883-2830905 TGCTTCATCTCCCGGAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900467016 Original CRISPR GGCGGGGGCGGGGGCGGGGC AGG (reversed) Intergenic