ID: 900467018

View in Genome Browser
Species Human (GRCh38)
Location 1:2830856-2830878
Sequence CAGGCGGCGGGGGCGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900467018_900467033 10 Left 900467018 1:2830856-2830878 CCCGCCCCCGCCCCCGCCGCCTG No data
Right 900467033 1:2830889-2830911 ATCTCCCGGAGCCCCGGCGAGGG No data
900467018_900467035 12 Left 900467018 1:2830856-2830878 CCCGCCCCCGCCCCCGCCGCCTG No data
Right 900467035 1:2830891-2830913 CTCCCGGAGCCCCGGCGAGGGGG No data
900467018_900467038 16 Left 900467018 1:2830856-2830878 CCCGCCCCCGCCCCCGCCGCCTG No data
Right 900467038 1:2830895-2830917 CGGAGCCCCGGCGAGGGGGAAGG No data
900467018_900467032 9 Left 900467018 1:2830856-2830878 CCCGCCCCCGCCCCCGCCGCCTG No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467018_900467030 -4 Left 900467018 1:2830856-2830878 CCCGCCCCCGCCCCCGCCGCCTG No data
Right 900467030 1:2830875-2830897 CCTGCTGCTGCTTCATCTCCCGG No data
900467018_900467034 11 Left 900467018 1:2830856-2830878 CCCGCCCCCGCCCCCGCCGCCTG No data
Right 900467034 1:2830890-2830912 TCTCCCGGAGCCCCGGCGAGGGG No data
900467018_900467031 4 Left 900467018 1:2830856-2830878 CCCGCCCCCGCCCCCGCCGCCTG No data
Right 900467031 1:2830883-2830905 TGCTTCATCTCCCGGAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900467018 Original CRISPR CAGGCGGCGGGGGCGGGGGC GGG (reversed) Intergenic