ID: 900467022

View in Genome Browser
Species Human (GRCh38)
Location 1:2830862-2830884
Sequence CAGCAGCAGGCGGCGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900467022_900467030 -10 Left 900467022 1:2830862-2830884 CCCGCCCCCGCCGCCTGCTGCTG No data
Right 900467030 1:2830875-2830897 CCTGCTGCTGCTTCATCTCCCGG No data
900467022_900467034 5 Left 900467022 1:2830862-2830884 CCCGCCCCCGCCGCCTGCTGCTG No data
Right 900467034 1:2830890-2830912 TCTCCCGGAGCCCCGGCGAGGGG No data
900467022_900467032 3 Left 900467022 1:2830862-2830884 CCCGCCCCCGCCGCCTGCTGCTG No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467022_900467033 4 Left 900467022 1:2830862-2830884 CCCGCCCCCGCCGCCTGCTGCTG No data
Right 900467033 1:2830889-2830911 ATCTCCCGGAGCCCCGGCGAGGG No data
900467022_900467042 26 Left 900467022 1:2830862-2830884 CCCGCCCCCGCCGCCTGCTGCTG No data
Right 900467042 1:2830911-2830933 GGGAAGGTGCCAGCGCCGTGAGG No data
900467022_900467031 -2 Left 900467022 1:2830862-2830884 CCCGCCCCCGCCGCCTGCTGCTG No data
Right 900467031 1:2830883-2830905 TGCTTCATCTCCCGGAGCCCCGG No data
900467022_900467035 6 Left 900467022 1:2830862-2830884 CCCGCCCCCGCCGCCTGCTGCTG No data
Right 900467035 1:2830891-2830913 CTCCCGGAGCCCCGGCGAGGGGG No data
900467022_900467038 10 Left 900467022 1:2830862-2830884 CCCGCCCCCGCCGCCTGCTGCTG No data
Right 900467038 1:2830895-2830917 CGGAGCCCCGGCGAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900467022 Original CRISPR CAGCAGCAGGCGGCGGGGGC GGG (reversed) Intergenic