ID: 900467023

View in Genome Browser
Species Human (GRCh38)
Location 1:2830863-2830885
Sequence GCAGCAGCAGGCGGCGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900467023_900467038 9 Left 900467023 1:2830863-2830885 CCGCCCCCGCCGCCTGCTGCTGC No data
Right 900467038 1:2830895-2830917 CGGAGCCCCGGCGAGGGGGAAGG No data
900467023_900467034 4 Left 900467023 1:2830863-2830885 CCGCCCCCGCCGCCTGCTGCTGC No data
Right 900467034 1:2830890-2830912 TCTCCCGGAGCCCCGGCGAGGGG No data
900467023_900467031 -3 Left 900467023 1:2830863-2830885 CCGCCCCCGCCGCCTGCTGCTGC No data
Right 900467031 1:2830883-2830905 TGCTTCATCTCCCGGAGCCCCGG No data
900467023_900467032 2 Left 900467023 1:2830863-2830885 CCGCCCCCGCCGCCTGCTGCTGC No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467023_900467035 5 Left 900467023 1:2830863-2830885 CCGCCCCCGCCGCCTGCTGCTGC No data
Right 900467035 1:2830891-2830913 CTCCCGGAGCCCCGGCGAGGGGG No data
900467023_900467042 25 Left 900467023 1:2830863-2830885 CCGCCCCCGCCGCCTGCTGCTGC No data
Right 900467042 1:2830911-2830933 GGGAAGGTGCCAGCGCCGTGAGG No data
900467023_900467033 3 Left 900467023 1:2830863-2830885 CCGCCCCCGCCGCCTGCTGCTGC No data
Right 900467033 1:2830889-2830911 ATCTCCCGGAGCCCCGGCGAGGG No data
900467023_900467043 30 Left 900467023 1:2830863-2830885 CCGCCCCCGCCGCCTGCTGCTGC No data
Right 900467043 1:2830916-2830938 GGTGCCAGCGCCGTGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900467023 Original CRISPR GCAGCAGCAGGCGGCGGGGG CGG (reversed) Intergenic