ID: 900467029

View in Genome Browser
Species Human (GRCh38)
Location 1:2830875-2830897
Sequence CCGGGAGATGAAGCAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900467029_900467038 -3 Left 900467029 1:2830875-2830897 CCTGCTGCTGCTTCATCTCCCGG No data
Right 900467038 1:2830895-2830917 CGGAGCCCCGGCGAGGGGGAAGG No data
900467029_900467032 -10 Left 900467029 1:2830875-2830897 CCTGCTGCTGCTTCATCTCCCGG No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467029_900467035 -7 Left 900467029 1:2830875-2830897 CCTGCTGCTGCTTCATCTCCCGG No data
Right 900467035 1:2830891-2830913 CTCCCGGAGCCCCGGCGAGGGGG No data
900467029_900467033 -9 Left 900467029 1:2830875-2830897 CCTGCTGCTGCTTCATCTCCCGG No data
Right 900467033 1:2830889-2830911 ATCTCCCGGAGCCCCGGCGAGGG No data
900467029_900467034 -8 Left 900467029 1:2830875-2830897 CCTGCTGCTGCTTCATCTCCCGG No data
Right 900467034 1:2830890-2830912 TCTCCCGGAGCCCCGGCGAGGGG No data
900467029_900467043 18 Left 900467029 1:2830875-2830897 CCTGCTGCTGCTTCATCTCCCGG No data
Right 900467043 1:2830916-2830938 GGTGCCAGCGCCGTGAGGCCAGG No data
900467029_900467042 13 Left 900467029 1:2830875-2830897 CCTGCTGCTGCTTCATCTCCCGG No data
Right 900467042 1:2830911-2830933 GGGAAGGTGCCAGCGCCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900467029 Original CRISPR CCGGGAGATGAAGCAGCAGC AGG (reversed) Intergenic