ID: 900467032

View in Genome Browser
Species Human (GRCh38)
Location 1:2830888-2830910
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900467019_900467032 8 Left 900467019 1:2830857-2830879 CCGCCCCCGCCCCCGCCGCCTGC No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467017_900467032 10 Left 900467017 1:2830855-2830877 CCCCGCCCCCGCCCCCGCCGCCT No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467024_900467032 -1 Left 900467024 1:2830866-2830888 CCCCCGCCGCCTGCTGCTGCTTC No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467028_900467032 -7 Left 900467028 1:2830872-2830894 CCGCCTGCTGCTGCTTCATCTCC No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467022_900467032 3 Left 900467022 1:2830862-2830884 CCCGCCCCCGCCGCCTGCTGCTG No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467018_900467032 9 Left 900467018 1:2830856-2830878 CCCGCCCCCGCCCCCGCCGCCTG No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467025_900467032 -2 Left 900467025 1:2830867-2830889 CCCCGCCGCCTGCTGCTGCTTCA No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467015_900467032 15 Left 900467015 1:2830850-2830872 CCCTGCCCCGCCCCCGCCCCCGC 0: 2
1: 23
2: 247
3: 947
4: 5070
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467027_900467032 -4 Left 900467027 1:2830869-2830891 CCGCCGCCTGCTGCTGCTTCATC No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467021_900467032 4 Left 900467021 1:2830861-2830883 CCCCGCCCCCGCCGCCTGCTGCT No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467016_900467032 14 Left 900467016 1:2830851-2830873 CCTGCCCCGCCCCCGCCCCCGCC No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467026_900467032 -3 Left 900467026 1:2830868-2830890 CCCGCCGCCTGCTGCTGCTTCAT No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467023_900467032 2 Left 900467023 1:2830863-2830885 CCGCCCCCGCCGCCTGCTGCTGC No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467029_900467032 -10 Left 900467029 1:2830875-2830897 CCTGCTGCTGCTTCATCTCCCGG No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data
900467020_900467032 5 Left 900467020 1:2830860-2830882 CCCCCGCCCCCGCCGCCTGCTGC No data
Right 900467032 1:2830888-2830910 CATCTCCCGGAGCCCCGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type