ID: 900468117

View in Genome Browser
Species Human (GRCh38)
Location 1:2835617-2835639
Sequence CAAGTGGCCCCCACTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900468114_900468117 2 Left 900468114 1:2835592-2835614 CCCAGGAGGTCATCTGGAAAAAC No data
Right 900468117 1:2835617-2835639 CAAGTGGCCCCCACTGAGAATGG No data
900468109_900468117 11 Left 900468109 1:2835583-2835605 CCCCCTGAACCCAGGAGGTCATC No data
Right 900468117 1:2835617-2835639 CAAGTGGCCCCCACTGAGAATGG No data
900468111_900468117 9 Left 900468111 1:2835585-2835607 CCCTGAACCCAGGAGGTCATCTG No data
Right 900468117 1:2835617-2835639 CAAGTGGCCCCCACTGAGAATGG No data
900468112_900468117 8 Left 900468112 1:2835586-2835608 CCTGAACCCAGGAGGTCATCTGG No data
Right 900468117 1:2835617-2835639 CAAGTGGCCCCCACTGAGAATGG No data
900468115_900468117 1 Left 900468115 1:2835593-2835615 CCAGGAGGTCATCTGGAAAAACA No data
Right 900468117 1:2835617-2835639 CAAGTGGCCCCCACTGAGAATGG No data
900468107_900468117 18 Left 900468107 1:2835576-2835598 CCGGAGGCCCCCTGAACCCAGGA No data
Right 900468117 1:2835617-2835639 CAAGTGGCCCCCACTGAGAATGG No data
900468110_900468117 10 Left 900468110 1:2835584-2835606 CCCCTGAACCCAGGAGGTCATCT No data
Right 900468117 1:2835617-2835639 CAAGTGGCCCCCACTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900468117 Original CRISPR CAAGTGGCCCCCACTGAGAA TGG Intergenic
No off target data available for this crispr