ID: 900469958

View in Genome Browser
Species Human (GRCh38)
Location 1:2848894-2848916
Sequence TCAGTTCCACACTCCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900469958_900469969 24 Left 900469958 1:2848894-2848916 CCTGGGTGGGAGTGTGGAACTGA No data
Right 900469969 1:2848941-2848963 GAAATGGAACCCTGTGTCCTGGG No data
900469958_900469960 -8 Left 900469958 1:2848894-2848916 CCTGGGTGGGAGTGTGGAACTGA No data
Right 900469960 1:2848909-2848931 GGAACTGAGCCCTGTGCCCTGGG No data
900469958_900469962 -4 Left 900469958 1:2848894-2848916 CCTGGGTGGGAGTGTGGAACTGA No data
Right 900469962 1:2848913-2848935 CTGAGCCCTGTGCCCTGGGTGGG No data
900469958_900469970 27 Left 900469958 1:2848894-2848916 CCTGGGTGGGAGTGTGGAACTGA No data
Right 900469970 1:2848944-2848966 ATGGAACCCTGTGTCCTGGGCGG No data
900469958_900469959 -9 Left 900469958 1:2848894-2848916 CCTGGGTGGGAGTGTGGAACTGA No data
Right 900469959 1:2848908-2848930 TGGAACTGAGCCCTGTGCCCTGG No data
900469958_900469971 28 Left 900469958 1:2848894-2848916 CCTGGGTGGGAGTGTGGAACTGA No data
Right 900469971 1:2848945-2848967 TGGAACCCTGTGTCCTGGGCGGG No data
900469958_900469961 -5 Left 900469958 1:2848894-2848916 CCTGGGTGGGAGTGTGGAACTGA No data
Right 900469961 1:2848912-2848934 ACTGAGCCCTGTGCCCTGGGTGG No data
900469958_900469966 8 Left 900469958 1:2848894-2848916 CCTGGGTGGGAGTGTGGAACTGA No data
Right 900469966 1:2848925-2848947 CCCTGGGTGGGAGTGTGAAATGG No data
900469958_900469968 23 Left 900469958 1:2848894-2848916 CCTGGGTGGGAGTGTGGAACTGA No data
Right 900469968 1:2848940-2848962 TGAAATGGAACCCTGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900469958 Original CRISPR TCAGTTCCACACTCCCACCC AGG (reversed) Intergenic
No off target data available for this crispr