ID: 900475865

View in Genome Browser
Species Human (GRCh38)
Location 1:2876065-2876087
Sequence CTGCATCCGCAGAGGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900475855_900475865 7 Left 900475855 1:2876035-2876057 CCTCAGACCCTCGCACCCCGCAG No data
Right 900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG No data
900475859_900475865 -8 Left 900475859 1:2876050-2876072 CCCCGCAGGAATCTGCTGCATCC No data
Right 900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG No data
900475854_900475865 24 Left 900475854 1:2876018-2876040 CCGCTCATGGGAAGGGTCCTCAG No data
Right 900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG No data
900475853_900475865 25 Left 900475853 1:2876017-2876039 CCCGCTCATGGGAAGGGTCCTCA No data
Right 900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG No data
900475858_900475865 -1 Left 900475858 1:2876043-2876065 CCTCGCACCCCGCAGGAATCTGC No data
Right 900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG No data
900475861_900475865 -10 Left 900475861 1:2876052-2876074 CCGCAGGAATCTGCTGCATCCGC No data
Right 900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG No data
900475852_900475865 26 Left 900475852 1:2876016-2876038 CCCCGCTCATGGGAAGGGTCCTC No data
Right 900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG No data
900475857_900475865 0 Left 900475857 1:2876042-2876064 CCCTCGCACCCCGCAGGAATCTG No data
Right 900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG No data
900475860_900475865 -9 Left 900475860 1:2876051-2876073 CCCGCAGGAATCTGCTGCATCCG No data
Right 900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900475865 Original CRISPR CTGCATCCGCAGAGGGAGTT GGG Intergenic
No off target data available for this crispr