ID: 900476101

View in Genome Browser
Species Human (GRCh38)
Location 1:2877075-2877097
Sequence CCAGCCGGTGGAGCGGCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900476101_900476111 23 Left 900476101 1:2877075-2877097 CCGGGCGCCGCTCCACCGGCTGG No data
Right 900476111 1:2877121-2877143 GTGCCTGGTTCCTGGCCTGCTGG No data
900476101_900476107 8 Left 900476101 1:2877075-2877097 CCGGGCGCCGCTCCACCGGCTGG No data
Right 900476107 1:2877106-2877128 TCTGCTGCCCACTCTGTGCCTGG No data
900476101_900476109 15 Left 900476101 1:2877075-2877097 CCGGGCGCCGCTCCACCGGCTGG No data
Right 900476109 1:2877113-2877135 CCCACTCTGTGCCTGGTTCCTGG No data
900476101_900476112 24 Left 900476101 1:2877075-2877097 CCGGGCGCCGCTCCACCGGCTGG No data
Right 900476112 1:2877122-2877144 TGCCTGGTTCCTGGCCTGCTGGG No data
900476101_900476114 30 Left 900476101 1:2877075-2877097 CCGGGCGCCGCTCCACCGGCTGG No data
Right 900476114 1:2877128-2877150 GTTCCTGGCCTGCTGGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900476101 Original CRISPR CCAGCCGGTGGAGCGGCGCC CGG (reversed) Intergenic