ID: 900476139 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:2877259-2877281 |
Sequence | CCAAAAATACTGCAGGAATA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
900476139_900476143 | 2 | Left | 900476139 | 1:2877259-2877281 | CCCTATTCCTGCAGTATTTTTGG | No data | ||
Right | 900476143 | 1:2877284-2877306 | AGTGACTCCCTTCCGCTCTGTGG | No data | ||||
900476139_900476147 | 14 | Left | 900476139 | 1:2877259-2877281 | CCCTATTCCTGCAGTATTTTTGG | No data | ||
Right | 900476147 | 1:2877296-2877318 | CCGCTCTGTGGACATGCCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
900476139 | Original CRISPR | CCAAAAATACTGCAGGAATA GGG (reversed) | Intergenic | ||
No off target data available for this crispr |