ID: 900476139

View in Genome Browser
Species Human (GRCh38)
Location 1:2877259-2877281
Sequence CCAAAAATACTGCAGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900476139_900476143 2 Left 900476139 1:2877259-2877281 CCCTATTCCTGCAGTATTTTTGG No data
Right 900476143 1:2877284-2877306 AGTGACTCCCTTCCGCTCTGTGG No data
900476139_900476147 14 Left 900476139 1:2877259-2877281 CCCTATTCCTGCAGTATTTTTGG No data
Right 900476147 1:2877296-2877318 CCGCTCTGTGGACATGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900476139 Original CRISPR CCAAAAATACTGCAGGAATA GGG (reversed) Intergenic
No off target data available for this crispr