ID: 900476531

View in Genome Browser
Species Human (GRCh38)
Location 1:2878843-2878865
Sequence TGTGGTCACCCTCGCTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900476531_900476537 11 Left 900476531 1:2878843-2878865 CCTCTTCAGCGAGGGTGACCACA No data
Right 900476537 1:2878877-2878899 TCCCCACCGTCCCCCGGTCATGG No data
900476531_900476539 12 Left 900476531 1:2878843-2878865 CCTCTTCAGCGAGGGTGACCACA No data
Right 900476539 1:2878878-2878900 CCCCACCGTCCCCCGGTCATGGG No data
900476531_900476535 5 Left 900476531 1:2878843-2878865 CCTCTTCAGCGAGGGTGACCACA No data
Right 900476535 1:2878871-2878893 ACGGCCTCCCCACCGTCCCCCGG No data
900476531_900476541 13 Left 900476531 1:2878843-2878865 CCTCTTCAGCGAGGGTGACCACA No data
Right 900476541 1:2878879-2878901 CCCACCGTCCCCCGGTCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900476531 Original CRISPR TGTGGTCACCCTCGCTGAAG AGG (reversed) Intergenic
No off target data available for this crispr