ID: 900476788

View in Genome Browser
Species Human (GRCh38)
Location 1:2879805-2879827
Sequence CCCAGGGATCTTCCCACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900476788_900476800 25 Left 900476788 1:2879805-2879827 CCACCTGTGGGAAGATCCCTGGG No data
Right 900476800 1:2879853-2879875 GGGGATGGCGGACACTAGCCCGG No data
900476788_900476798 13 Left 900476788 1:2879805-2879827 CCACCTGTGGGAAGATCCCTGGG No data
Right 900476798 1:2879841-2879863 TCCTGCTCAGCTGGGGATGGCGG No data
900476788_900476794 4 Left 900476788 1:2879805-2879827 CCACCTGTGGGAAGATCCCTGGG No data
Right 900476794 1:2879832-2879854 TCTTTTGTCTCCTGCTCAGCTGG No data
900476788_900476797 10 Left 900476788 1:2879805-2879827 CCACCTGTGGGAAGATCCCTGGG No data
Right 900476797 1:2879838-2879860 GTCTCCTGCTCAGCTGGGGATGG No data
900476788_900476801 26 Left 900476788 1:2879805-2879827 CCACCTGTGGGAAGATCCCTGGG No data
Right 900476801 1:2879854-2879876 GGGATGGCGGACACTAGCCCGGG No data
900476788_900476796 6 Left 900476788 1:2879805-2879827 CCACCTGTGGGAAGATCCCTGGG No data
Right 900476796 1:2879834-2879856 TTTTGTCTCCTGCTCAGCTGGGG No data
900476788_900476795 5 Left 900476788 1:2879805-2879827 CCACCTGTGGGAAGATCCCTGGG No data
Right 900476795 1:2879833-2879855 CTTTTGTCTCCTGCTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900476788 Original CRISPR CCCAGGGATCTTCCCACAGG TGG (reversed) Intergenic
No off target data available for this crispr