ID: 900477132

View in Genome Browser
Species Human (GRCh38)
Location 1:2881361-2881383
Sequence CTGTCTAGAGGGGTGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
900477122_900477132 5 Left 900477122 1:2881333-2881355 CCTGGGTGGGGTAGTGGCGCCTG No data
Right 900477132 1:2881361-2881383 CTGTCTAGAGGGGTGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900477132 Original CRISPR CTGTCTAGAGGGGTGGGGGC AGG Intergenic
No off target data available for this crispr